Preconcentration Laboratory . Laboratory of Chromatography . ... Laboratory of Kinetics Methods of Anaysis . ... Sorption-spectroscopy methods for determination of organic . ... Room-temperature ionic liquds, computational chemistry . ... New detection methods in ion and ion-pair chromatography . ... For that purpose, methods of selective preconcentration are developed along with the methods of determination of analytes directly in the sensing film or in the permeate after membrane diffusion. ...

Еще в разделе: (Показать все результаты (>45) - analyt.chem.msu.ru/ )

... Department of Computational mathematics and cybernetics , Lomonosov Moscow State University . ... Thesis title "Machine learning approach for automatic performance tuning of parallel program", supervisor Dr. Nina N. Popova. ... High-performance computing, automatic performance tuning, machine learning algorithms, evolutionary and bio-inspired programming, parallel algorithms in VLSI design . ... Algorithms and framework for automatic selection and tuning parameters of parallel sparse linear solvers....

Еще в разделе: (Показать все результаты (>7) - angel.cmc.msu.ru/ )

... Submit a Paper . Before submitting your paper for the ICONO/LAT 2013 please read the guidelines for preparation of the conference papers. We manage all paper submissions for the ICONO/LAT 2013 with the help of the Lomonosov Scientific Portal developed at the Lomonosov Moscow State University specifically for the conferences needs. Pushing the button below you will leave the conference site and go to the Lomonosov portal for papers submission. ... Program overview . ... Registration info . ...

Еще в разделе: (Показать все результаты (>22) - iconolat13.phys.msu.ru/ )

• Foreword
• Invited speakers
• Program topics

COMPUTER DESIGN OF HETEROCYCLIC RING-OPENING REACTIONS. ... Since the cleavage of ring bond requires appearance of new bond either between th e (endo) atoms of initial cycle, or between initial cycle and external (exo) group, the first case is treated as endoopening, and the another as exo-opening: Endo-Ring Opening Exo-Ring Opening © 1995 American Institute of Physics 75 7 758 Heterocyclic Ring-Opening Reactions General Methodology and Algorithms 1. ... RULE FOR ENDO-TYPE RJNG OPENING. ...

Еще в разделе: (Показать все результаты (>175) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/028e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/032e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/029e.pdf

... This book contains scientific papers prepared by researchers of Moscow State University and Autonomous University of Puebla in accordance with a special Russian--Mexican scientific program. ... Institute of Mathematical Studies of Complex Systems, Moscow State University . ... Institute of Nuclear Physics, Moscow State University . ... The book is edited by Rector of Moscow State University Dr. V.A. Sadovnichii and Rector of Autonomous University of Puebla Dr. E. Doger Guerero. ...

Еще в разделе: (Показать все результаты (>290) - num-anal.srcc.msu.ru/ )

... Science Park . ... Agency for networking, information and communication technologies ( NETINFOKOM LLC) ank-nic@rambler.ru http://www.msunews.ru/ . ... Developing the infrastructure and information support needed for projects that provide an interdisciplinary exchange of science information and the potential for collective work on the base of network services and technologies. ... The company has a great deal of experience in the design, development and penetration of laboratory information systems. ...

Еще в разделе: (Показать все результаты (>17) - www.sciencepark.ru/ )

• MSU Science Park - Projects & Partners
• MSU Science Park - News
• MSU Science Park - About us

... Lomonosov Moscow State University . ... Home About Communication and Information Department . ... Our main areas of expertise are information exchange, building network partnerships, development of complex internet applications and solutions, implementing e-learning practices.б  . ... Dr. of Science (biology) Alexander O. Makeev Graduated from Geographic Faculty of Lomonosov Moscow State University. ... Alexander Ladygin graduated from department of Biology of Lomonosov Moscow State University. ...

Еще в разделе: (Показать все результаты (>62) - ecfs.msu.ru/ )

• Agricultural markets and global state of food suply | ECFS
• The Department of land resources | ECFS

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>25) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Department of Vertebrate Zoology . PhotoGallery 'Field Practice at the White Sea' . The White Sea Biological Station is located on the very coast of Kandalaksha Bay of the White Sea. ... The Vertebrate Zoology course with Dr. Sergei V. Ogurtsov (assoc. prof. of the Department of Vertebrate Zoology) describes the biodiversity and the variety of ecological groups of vertebrates of the White Sea region through the methods of species recognition by songs, tracks, fecal pellets etc. ...

Еще в разделе: (Показать все результаты (>81) - vertebrata.bio.msu.ru/ )

• Education
• Sergei V. Ogurtsov
• Department of Vertebrate Zoology

... Moscow State University . ... Research . ... Professor, Dept. of Computation Mathematics and Computer Science, . Kuban State University . ... Evgeny A. Demekhin obtained his Diploma (1972) from the Kuban State Technological University and his Ph.D. (1981) from the M.V.Lomonosov Moscow State University. From 1981 to 1984 he was a Postdoc at the Kuban State Technological University, and from 1984 to 1991 he has been working at the Oil Research Institute at Krasnodar as a research fellow. ...

Еще в разделе: (Показать все результаты (>60) - nanofluidics.phys.msu.ru/ )

• Theses
• Alexander Potapov
• Olga I. Vinogradova

Moscow State University, Geobotany dpt. ... Home Написание научных статей Программа . ... История научных публикаций. ... Особенности написания основных разделов: введение (обзор литературы, цели и задачи исследования), методика (характеристика района исследований, сбор полевого материала, статистическая обработка данных), результаты, обсуждение, выводы. ... ПРЕДСТАВЛЕНИЕ РЕЗУЛЬТАТОВ ИССЛЕДОВАНИЙ В ВИДЕ ДОКЛАДА . ... Особенности написания тезисов доклада. ... Особенности подготовки устного доклада. ...

Еще в разделе: (Показать все результаты (>890) - herba.msu.ru/ )

• The Linnaean Collection of the Herbarium of Moscow State University: digital
• Moscow State University Botanical Server
• Biological station "Lake Moldino". Materials

... 1 Figure 1: The density distribution in R­Z plane Figure 2: The luminosity distribution in R­Z plane for Maxwellian kick velocity (75 km/s) 2 Figure 3: The luminosity distribution in R­Z plane for Maxwellian kick velocity (150 km/s) n(R; Z) = nHI + 2 \Delta nH2 nH2 = n 0 \Delta exp џ \GammaZ 2 2 \Delta (70pc) 2 – If 2kpc џ R џ 3:4kpc, then nHI = n 0 \Delta exp џ \GammaZ 2 2 \Delta (140pc \Delta R=2kpc) 2 – ; For R џ 2kpc n(R; Z) was assumed to be constant: n(R ! ...

Еще в разделе: (Показать все результаты (>585) - xray.sai.msu.ru/ )

• No Title
• Константин Александрович Постнов
• Natalya Raguzova Home Page

... Improvement of Java type compiler using in language independent remote process calls in KBase project. 09/2011 ­ present: Moscow State University, Dept. of Bioengineering and Bioinformatics (Russia) Scientific Research Java developer and lecturer Enhanced the CAMPS web resource (http://webclu.bio.wzw.tum.de/CAMPS2.0/) that enables multiple classification of transmembrane proteins. ... Developed web based UI for visualization of a graph of transmembrane protein families. ... Sutormin RA, Mironov AA. ...

Еще в разделе: (Показать все результаты (>12) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2014.pdf