... A dual-beam thermal lens spectrometer is used as a detector in HPLC. ... A comparison of the methods for calculating the performance characteristics from peak heights (conventional approach) and peak areas showed that the latter variant gives more reliable results. ...

Еще в разделе: (Показать все результаты (>1018) - chem.msu.ru/ )

Calculations of interactions in biomolecular systems: comparison of quantum and classical approaches" . Bazhanova Z.G., Khrenova M.G., Nemukhin A.V. Methodical aspects of molecular mechanics, quantum chemistry, and combined quantum mechanics/molecular mechanics (QM/MM) approaches are discussed with respect to the intermolecular interaction calculations between some aminoacids (arginine, histidine, and serine) and water molecules. ... PostScript (in Russian) (1.28MB) . ...

Еще в разделе: (Показать все результаты (>477) - num-meth.srcc.msu.ru/ )

• "Comparison of the Verlet table and cell-linked list algorithms for sequential,
• "An algorithm for calculating the equilibrium state of a ferromagnetic by the
• "A study on efficiency of algorithms for calculating the flows bounded by

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Algorithms for calculating parameters of virtual scenes in computer vision tasks . ...

Еще в разделе: (Показать все результаты (>297) - graphics.cs.msu.ru/ )

• Video Frame Rate Double Up-Conversion | Graphics and Media Lab
• Video Frame Rate N-Times Up-Conversion | Graphics and Media Lab
• Video Frame Rate N-Times Up-Conversion | Лаборатория компьютерной графики и

... Comparison of soluble and placental transferrin receptors as standards for the determination of soluble transferrin receptor in humans. ... 1500 kDa, whereas the MW of sTfR corresponded to 237 kDa. ... The serum sTfR levels calculated against sTfR were 2.5 times lower than those calculated against pTfR. Serum sTfR levels are overestimated when pTfR is used as the standard. ...

Еще в разделе: (Показать все результаты (>51) - biochem.bio.msu.ru/ )

Электронная библиотека Попечительского совета . ... Mangano S. - XSLT Cookbook . ... Название: XSLT Cookbook . ... The 136 solutions to commons problems address string processing, mathematics, dates and times, document traversal, XML queries, HTML, scalable vector graphics, code generation, debugging, and generic programming. ... automation, code generation, XSLT from XSLT . ... Code . ... code, generation, XSLT from XSLT . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>9126) - lib.mexmat.ru/ )

• Adamchik V.S., Marichev O.I. - The algorithm for calculating integrals of
• Cabay S., Labahn G. - A Fast, Reliable Algorithm for Calculating Pade-Hermite
• Ng E.W. - A Comparison of Computational Methods and Algorithms for the Complex

... In order to compare the number of different evolutionary stages obtained and X-ray luminosity of the chosen X-ray sources with the observed galactic values we use the sum of C/O+O/C , where C and O are the calculated and observed values of a given binary type, respectively. If we make comparison for a number of different binary species (for example, we compare the number of CV, number of X-ray pulsars,   total X-ray luminosity of LMXB, etc.), we write this criterion in the form: . ...

Еще в разделе: (Показать все результаты (>328) - xray.sai.msu.ru/ )

• Basic Observational Data for Determination of f(q) and
• Restrictions on the Scenario Parameters
• Principles of Scenario Machine Operation

Application of evolutionary model in the evaluation of the quality of pair wise alignment of amino acid sequences Valery Polyanovsky, V. G. Tumanyan Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, 119991 Russia ... : polyanovskyvo@mailfrom.ru, tuman@eimb.ru The purpose of the work is to develop a universal method for estimating the pairwise alignment quality depending on the evolutionary distance (degree of homology) between the ... REFERENCES 1. ...

Еще в разделе: (Показать все результаты (>219) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/37.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/143.pdf

This page briefly describes the texture filtering modes implemented in the current release of PolyWorld Engine. The following is a sample MIP-map texture generated from a regular 256x256 texture map. ... This map is usually referred to as a 4D Pyramid Anisotropic Filtering map. Only one, isotropic integer MIP level is calculated (MIP u = MIP v ). ... Unlike the Bilinear Filtering case shown above, rational isotropic MIP level is calculated . ... color = lrp (color1, color2, frc_MIP); . ...

Еще в разделе: (Показать все результаты (>18) - www.kge.msu.ru/ )

... These functions all manipulate strings in various ways. ... bin2hex -- Convert binary data into hexadecimal representation . ... chr -- Return a specific character . ... convert_cyr_string -- Convert from one Cyrillic character set to another . count_chars -- Return information about characters used in a string . ... strncasecmp -- Binary safe case-insensitive string comparison of the first n characters . ... strncmp -- Binary safe string comparison of the first n characters . ...

Еще в разделе: (Показать все результаты (>174) - oit.cmc.msu.ru/ )

• strnatcmp
• strnatcasecmp
• similar_text

... These spectral characteristics compare with introduction (ВВЕДЕНИЕ) At last time many workers have studied thermal Rayleigh-Benard convection using numerical At last time many workers have studied thermal Rayleigh- Benard convection using numerical time many At last time many workers have studied thermal Rayleigh-Benard convection using numerical used spectral methods with periodic boundary conditions. ... In numerical simulations were derived secondary stationary, [pic] where ? ...

Еще в разделе: (Показать все результаты (>13) - hit-conf.imec.msu.ru/ )

This diagram shows the six superimposed "layers" of the CSS table model. This diagram illustrates the algorithm for calculating a cell's final background. ... The diagram shows how, looking down on the six rectangles, one may compute the background color of each cell. ... A cell without a background color in the top layer is depicted as a "window" onto the lower layers, which give its final background color. ...

Еще в разделе: (Показать все результаты (>515) - crydee.sai.msu.ru/ )

• Long description of example illustrating background calculation
• Long description of example illustrating table row height calculations and

Annotation to the diploma of Aleksei Konjashkin Peculiarities of generation and amplification of diode pumped Nd:YAG picosecond laser The aim of diploma is the estimation of focal length of thermal lens arising in active element depending from the diode pump pulses rate and energy. ... The next aim was the calculation and adjustment of compact two pass amplifying system and comparison of the characteristics of two amplifiers of picosecond pulses with lamp and diode pump. ...

Еще в разделе: (Показать все результаты (>121) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2011/Tarakanov_Yanyshev_en.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Comparison of protein phylogeny reconstruction methods

Hide Zen home . ... Index . ... Do we really need them for database indexing ? ... We need simple numbering scheme, so that for any given point we could easily calculate the number of "pixel", this is what HealPix provides and lacks HTM. ... During Rtree queries the number of index blocks read is several times greater than during Q3C queries. ... But in Q3C scheme, as we showed before, the circle is segmented, so we extract from the database only a few percents more data than occur in the circle. ...

Еще в разделе: (Показать все результаты (>1456) - www.sai.msu.su/ )

• SAL- Other Scientific Fields - Chemistry, Biology Related - ChemApp
• SAL- Other Scientific Fields - Chemistry, Biology Related - Evalign
• SAL- Other Scientific Fields - Chemistry, Biology Related - MEXICO

... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...

Еще в разделе: (Показать все результаты (>139) - bioinf.fbb.msu.ru/ )

• Algorithm
• SDPlight

THE PARAMETERS INVOLVED IN HAPKE'S MODEL FOR ESTIMATION OF THE COMPOSITION OF THE EJECTA LUNAR TERRAINS. ... In the previous papers we were estimated the surface roughness of the ejecta lunar terrains by means comparison of the local phase function and the average integrated lunar indicatrix. ... The Hapke's theoretical model of the lunar surface reflection. ... For THE PARAMETERS INVOLVED IN HAPKE'S MODEL: S.G. Pugacheva, V.V. Shevchenko a low-albedo lunar surface parameter Bo = 1. ...

Еще в разделе: (Показать все результаты (>83) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Ber/Publications/ms40/88_Yamashita%20et_al.pdf
• http://selena.sai.msu.ru/Pug/Publications/m44_70_pugacheva.pdf
• http://selena.sai.msu.ru/Pug/Publications/ms38/ms080.pdf

Arushanyan O.B., Volchenskova N.I., Zaletkin S.F. Calculation of expansion coefficients of series in Chebyshev polynomials for a solution to a Cauchy problem // Moscow University Mathematics Bulletin.2012. ... 211-216. ... The solution of such a system and its derivatives are expanded in shifted series in Chebyshev polynomials of the first kind. Algorithms to determine the expansion coefficients are described. ...

Еще в разделе: (Показать все результаты (>104) - srcc.msu.ru/ )

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>82) - scon155.phys.msu.su/ )

Angular acceptance Old source E=2.8 eV, mono Update on OM GEANT4 simulation · Thin layer optical model: D. Motta, S. SchЖnert, NIMA 539 (2005) 217 Thin layer Optical Model From Motta et al paper internal note ANTARES-OPMO-2009-003 GEANT4 default Good agreement Thin layer Optical Model implemented in GEANT4 Comparison PMT Scan. Level of gel = 10.85 cm Full reflection PMT Scan. Level of gel = 11.35 cm Angular acceptance ToDo List Error calculation Final acceptance release eta_E calculation K40 rate

Еще в разделе: (Показать все результаты (>16) - antares.sinp.msu.ru/ )

A.N. Belozersky Institute . Bioinformatics Portal . ... Russian EMBnet Node . ... AliBee - Multiple alignment Release 2.0 . ... Grants information . ... Our Institute is a scientific department of Moscow State University. ... Address: Belozersky Institute,Moscow State University,Leninskie Gory 1,Bldg. ... Information about our activities and EMBnet resources around the World is available here . Information about our educational activities with kids, children and teenagers is available here . ...

Еще в разделе: (Показать все результаты (>148) - www.genebee.msu.ru/ )

• IGLA-3D User Guide
• AliComp - GeneBee Alignments Comparison - Advanced
• AliComp - GeneBee Alignment Comparison Help