Division of Geology . ... Division of Hydrogeology and Engineering Geology . ... Faculty of geology > English > Divisions & Departments . ... The graduates of "Engineering geology" specialization must have a vast geological background and know the state-of-the-art methods of studies and forecast of engineering-geological conditions for industrial, urban, hydrotechnical, road and underground construction. ... 119899, Russia, Moscow, Leninskie gory, Moscow State University, Faculty of geology. ...

Еще в разделе: (Показать все результаты (>10) - www.geol.msu.ru/ )

... Поиск по МГУ | Лента новостей | ... Новости . ... Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . Комментарии к новости: Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . ... Они перешли на разработанный выпускником мехмата МГУ имени М.В. Ломоносова мобильный мессенджер FireChat, который использует Wi-Fi и Bluetooth. ... 2003 2011 MsuNews.Ru Новости МГУ . ...

Еще в разделе: (Показать все результаты (>2) - www.msunews.ru/ )

... OCEAN ACOUSTICS. ... It is proposed to use high frequency resolution methods of sonographic analysis (spectral­ time representation) of projections of the acoustic power flux vector for spatial resolution of sources that pro vide a higher signal to noise level at the output of the processing system. ... The problem of obtaining an acoustic image is extremely difficult, since the required spatial source resolution at low frequencies is usually several times smaller than the acoustic wavelength. ...

Еще в разделе: (Показать все результаты (>3) - acoustics.phys.msu.ru/ )

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>2) - srd.sinp.msu.ru/ )

) REGUL ATION (EC) No 1906/2006 OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL of 18 December 2006 laying down the rules for the par ticipation of under takings, research centres and universities in actions under the Seventh Framework Programme and for the dissemination ... relevance) THE EUROPEAN PARLIAMENT AND THE COUNCIL OF THE EUROPEAN UNION, (3) Having regard to the Treaty establishing the European Community , and in particular ... Article 48 Article 50 Principles Access rights for use 1. ...

Еще в разделе: (Показать все результаты (>17) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/press_release_StG_2012.pdf
• http://ideas.msu.ru/docs/press_release_2012.doc
• http://ideas.msu.ru/docs/Work_programme_2011.pdf

... Submit your article . ... The article reveals peculiarities of the development of the high-tech sphere in the global economic environment. ... The role of venture ecosystem as a source of development of the high-tech sphere is examined in the article. The author identifies the problems of development of Russian venture ecosystem and demonstrates its prospects of an effective symbiosis of the state and the private initiatives against the background of favourable institutional conditions. ...

Еще в разделе: (Показать все результаты (>5) - ee-journal.spa.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

148. Dye-sensitized Solar Cells ? Materials and Interfaces | Научно-образовательный

149. http://www.elch.chem.msu.ru/mole/lecture/qavdeev.pdf