Division of Geology . ... Division of Hydrogeology and Engineering Geology . ... Faculty of geology > English > Divisions & Departments . ... The graduates of "Engineering geology" specialization must have a vast geological background and know the state-of-the-art methods of studies and forecast of engineering-geological conditions for industrial, urban, hydrotechnical, road and underground construction. ... 119899, Russia, Moscow, Leninskie gory, Moscow State University, Faculty of geology. ...
... Поиск по МГУ | Лента новостей | ... Новости . ... Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . Комментарии к новости: Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . ... Они перешли на разработанный выпускником мехмата МГУ имени М.В. Ломоносова мобильный мессенджер FireChat, который использует Wi-Fi и Bluetooth. ... 2003 2011 MsuNews.Ru Новости МГУ . ...
... OCEAN ACOUSTICS. ... It is proposed to use high frequency resolution methods of sonographic analysis (spectral time representation) of projections of the acoustic power flux vector for spatial resolution of sources that pro vide a higher signal to noise level at the output of the processing system. ... The problem of obtaining an acoustic image is extremely difficult, since the required spatial source resolution at low frequencies is usually several times smaller than the acoustic wavelength. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011 Похожие документы
... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...
) REGUL ATION (EC) No 1906/2006 OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL of 18 December 2006 laying down the rules for the par ticipation of under takings, research centres and universities in actions under the Seventh Framework Programme and for the dissemination ... relevance) THE EUROPEAN PARLIAMENT AND THE COUNCIL OF THE EUROPEAN UNION, (3) Having regard to the Treaty establishing the European Community , and in particular ... Article 48 Article 50 Principles Access rights for use 1. ...
... Submit your article . ... The article reveals peculiarities of the development of the high-tech sphere in the global economic environment. ... The role of venture ecosystem as a source of development of the high-tech sphere is examined in the article. The author identifies the problems of development of Russian venture ecosystem and demonstrates its prospects of an effective symbiosis of the state and the private initiatives against the background of favourable institutional conditions. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Научные семинары . ... расписание семинаров . семинар 1 . ... Отчет о семинаре || ... This talk will focus on one of the emerging technology for solar light conversion into electricity; the dye-sensitized solar cell. ... The present lecture will give a general background to the solar energy field with a focus on dye-sensitized solar cells. ... С докладом Dye-sensitized Solar Cells Materials and Interfaces выступил профессор Lars Kloo из Королевского технологического института г. Стокгольма. ...
... Is it necessary to do the beam weaker? ... Q: If the mixture of powders consists of both isotropic and anisotropic particles, is it possible to estimate the ratio of isotropic and anisotropic parts? If I understand the question correctly, one asks, if one has a fraction of oriented anisotropic particles and a fraction of the disoriented anisotrpic particles (i.e. one has somewhat partial texture in the powder sample), then is it possible to find out these fractions? ...
Monitoring of chloride and chloride-selective ion channels activity using genetically encoded fluorescent sensors. ... Quinoline-based fluorescent dyes sensitive to Cl have low biological toxicity, relatively good sensitivity and selectivity to Cl and rapid response to changes in Cl. ... Thus, development of molecules with sensitivities closer to this physiological range would provide a useful tool for monitoring Cl in biological preparations. ...
Home Search Collections Journals About Contact us My IOPscience On the problem of the spontaneous exchange-driven electron interwell re-population in semiconductor quantum wells This article has been downloaded from IOPscience. ... The wave function for an electron in the second well has a similar form. ... Now our goal is to prove that for any electron state with all electrons in one well one can build another state with electrons equally populating both wells, which is lower in energy. ...
PALAEOPATHOLOGY IN RUSSIA: HISTORICAL BACKGROUND A. Buzhilova Institute and Museum of Anthropology, MSU, Moscow В статье предлагается версия хронологических этапов становления палеопатологии в России. Особое внимание уделяется первым работам в области палеопатологии, представленным основателями физической антропологии в России - К.М. Бэром и Д.Н. Анучиным. Рассматривается вклад основателя русской школы палеопатологии Д.Г. Рохлина. ... Бужилова А.П. Homo sapiens: история болезни. ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/091/3.pdf -- 179.0 Кб -- 19.08.2010
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/091/3.pdf -- 179.0 Кб -- 19.08.2010 Похожие документы
February 11, 1997 Neurokinetics Case Study Background 2 The Bionic Glove 2 Details 2 Development 3 Commercialization 4 The Issues 4 Intellectual Property 4 The Market 5 Distribution 7 Clinical Trials 7 Product Development 9 Regulatory Considerations 10 Sales Projections 11 Financing 12 Commercial ... Research indicated that the target market for Canada and the United States combined was approximately 76,850 existing patients with 2,850 new patients anticipated each year. ... patients | ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/neurokineticscasestudy.doc -- 189.0 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/neurokineticscasestudy.doc -- 189.0 Кб -- 27.10.2005 Похожие документы
... On-line консультант . ... Приглашаем всех, интересующихся исследованиями и разработками в области компьютерных сетей, принять участие в семинаре по software-defined networking, который состоится 4 июля 2011 (понедельник) в 19.30 в Политехническом музее (Новая площадь, д 34;, подъезд 9, малая аудитория). ... We are about to witness a revolution in the networking towards so-called "Software Defined Networking" (SDN). SDN enables innovation in all kinds of networks . ... Copyright ВМиК МГУ , 2008 . ...
... Seminar archive . ... Type Ia Supernovae (SNe Ia) have an important role to measure a distance to an anonymous galaxy because they have a good correlation of the decline rates of the light curves with the absolute luminosity. ... First, super-Chandrasekhar SNe which have extremely high luminosity, slow decline rate of the light curves, slow expansion velocity and strong carbon features. ... As another example of diversity of SNe Ia, I would like also to introduce Type Iax SNe. ... All seminars: . ...
Curriculum Vitae . ... Degree: candidate of science in mathematics and physics (PhD), obtained from Lomonosov Moscow State University (2006) . ... 2003 - 2006 . Lomonosov Moscow State University , Faculty of Computational Mathematics and Cybernetics . ... Lomonosov Moscow State University , Faculty of Physics . ... Kurchatov student scholarship at Lomonosov Moscow State University . ... Young Scientists Summer Program at International Institute for Applied System Analysis ( Laxenburg , Austria ) . ...
... The method of polariton scattering spectroscopy is based on the effect of the spontaneous decay of a pump photon (w 1 , k 1 ) into a signal photon (w s , k s ) and a polariton (w p , k p ) in a nonlinear crystal without the centre of symmetry. ... The higher-order vibrations, as a rule, make small contributions into the dispersion dependences of linear and nonlinear susceptibilities and are difficult to study by means of traditional Raman and IR methods. ...
e-mail: ogubin@ucla.edu) , , , , , , - (), multiparadigmatic sociology, paradigm of inquiry, multivariate paradigm, interpretive paradigm, historical paradigm, latently-implicit conceptual-theoretical multiparadigmatism (LITM) , , , , . ... These paradigms covertly exist in the form of foreground and background arguments in major classical sociological works that, in its turn, points out to the latently-implicit conceptualtheoretical multiparadigmatism (LITM) of sociology. ...
[
Текст
]
Ссылки http://www.socio.msu.ru/vestnik/archive/2011/4/08.pdf -- 125.8 Кб -- 06.11.2012
[
Текст
]
Ссылки http://vestnik.socio.msu.ru/archive/2011/4/08.pdf -- 125.8 Кб -- 12.01.2015 Похожие документы