... News from the UNESCO Chair on Global Problems . ... ABOUT THE CHAIR . ... GENERAL INFORMATION ABOUT THE CHAIR . ... STAFF OF THE CHAIR . ... NETWORK OF THE CHAIR . ... Школа ЮНЕСКО / UNESCO SCHOOL . Визит Генерального директора ЮНЕСКО . ... Home News from the UNESCO Chair on Global Problems . ... 2005-2013 Факультет глобальных процессов МГУ имени М.В. Ломоносова / Исполнение и поддержка ресурса: Союз молодых ученых и специалистов Евразии ...

Еще в разделе: (Показать все результаты (>5) - unesco.fgp.msu.ru/ )

• ОБЩАЯ ИНФОРМАЦИЯ О КАФЕДРЕ ? GENERAL INFORMATION ABOUT THE CHAIR Кафедра ЮНЕСКО
• Кафедра ЮНЕСКО по изучению глобальных проблем на факультете глобальных

... Dahl's texts and dictionaries in the Web (in Russian) . ... Employees of the Laboratory . ... About Laboratory . ... Anatoly Anatol'evich Polikarpov - a head of the laboratory - professor of Russian Language Department [ click here for personal information ] . ... About the laboratory . ... Development of techniques of gathering and analysis of mistakes of foreigners in Russian speech (a series of works of 1985-1991 under the leadership of A.A.Polikarpov with principal assictance by O.V.Kukushkina);...

Еще в разделе: (Показать все результаты (>67) - old.philol.msu.ru/ )

• MSU - Laboratory for General and Computational Lexicology and Lexicography
• Konferences
• MSU-LGCLL:: Papers submitted to QUALICO-94

Contamination of soils and deeper sediments by toxic metals, metalloids, and radionuclides is a worldwide problem due to improper disposal practices, spills, atmospheric deposition of combustion emissions, and intentional application of sludges, fertilizers, or other materials. ... Microbial reduction of chromate, for example, may convert highly mobile Cr(VI) to less mobile Cr(III). In other cases, changes in metal redox state may be indirectly caused by microbial activity. ...

Еще в разделе: (Показать все результаты (>18) - eco.soil.msu.ru/ )

DNS Security, Stability and Resiliency John Crain Chief Technical Officer April 21st 2009 Garmisch 1 Monday, 20 April 2009 Agenda · The Global DNS SSR Symposium · Problems and Opportunities · Questions? ... The level of awareness with respect to the DNS is very low" ­ All quotes from Symposium Report 7 Monday, 20 April 2009 Problems & Opportunities 8 Monday, 20 April 2009 Problem: · There is a need for training across all sectors of the industry to raise both skills and awareness. ...

Еще в разделе: (Показать все результаты (>16) - iisi.msu.ru/ )

... GeneBee . ... Courses in Bioinformatics . ... What is GCG? ... Usage of GCG Package on GeneBee Server . ... What is WhatIf? ... Computer Class . ... Due to colaborate work of many laboratories the total length of published nucleotide sequences is now . ... GCG vs. ... Usage of GCG Package on GeneBee server . ... Computer class . ... Computer class is used for bioinformatic courses and for scientific semenars. ... Everyone who need a consultation for GeneBee service, GCG or WhatIf package is welcomed...

Еще в разделе: (Показать все результаты (>167) - www.genebee.msu.ru/ )

• LMI projects
• screening by keywords
• DIMACS Series in Discrete Mathematics

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Align tool for DNA-protein complexes

The Department of Talented Youth Affairs and Professional Orientation . ... Law graduates turned in a good performance in the competition ?Foreign Direct Investment Arbitration Moot? ... November 30, 2015, an interactive roundtable meeting on ?Problems of continuous psychological and educational support of gifted children: domestic and foreign experience? was held. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>30) - talant.msu.ru/ )

... Individual SELEX products, aptamers, are small molecules (40­100 nt) that have a unique three-dimensional structure, which provides for their specific and high-affinity binding to targets varying from low-molecular-weight ligands to proteins. ... Selection of aptamers binding with a target is the key step in SELEX, as aptamers account for only a small fraction of the initial library (one aptamer per 109 to 1013 molecules) [6]. ... Fourth, modification can increase the aptamer affinity for a target. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... During the round table, NAMMI and Lomonosov Moscow State University were represented by Sergey Smirnov, associate professor of the Faculty of Journalism of Lomonosov Moscow State University. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>31) - www.journ.msu.ru/ )

... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...

Еще в разделе: (Показать все результаты (>212) - astro.uni-altai.ru/ )

Support ] [ Links to DC resistivity and IP software in WWW ] . ... TRF_2D for Windows - Automated 2D Inversion Program for VES Travers Data. ... The scientists of the laboratory are developing algorithms and computer programs for decision of forward and inverse problems of resistivity and induced polarization methods, which are widely known in Russia and are applied in many countries abroad. ... IE2DL - the set of the programs for resistivity and IP data modeling in 2D inhomogeneous media . ...

Еще в разделе: (Показать все результаты (>72) - geophys.geol.msu.ru/ )

• Anis. Page2
• Links of engineering geophysics and software
• TES. Modeling example.

... Что такое ОТиПЛ? ... Here you can download all linguistic problems from individual and team contests of the First International Olympiad with solutions (a PDF version in ZIP archive, approx. ... Problems from the II round of the XXXIII Moscow Olympiad: . 33Tur2.pdf (690 K), 33Tur2.zip (archived, 168 K) . Solutions for the II round: . otvet33_2.pdf (268 K), otvet33_2.zip (archived, 80 K) . ... Int'l Olympiad-2004 . ... Participants . ... Linguistic problems . ... Problems and solutions . ...

Еще в разделе: (Показать все результаты (>355) - www.philol.msu.ru/ )

• International Congress of Russian Language researches - preliminary program

... This 0.5 - year course is devoted to the principles of mathematical modeling in human investigation on physical, economical and social natures. ... Modern Operating Systems . ... This is introductory course to computer network technologies. ... It covers vary basically ISO OSI RM, TCP/IP protocol stack, Ethernet and WiFi principles, core network technologies, PSTN and GSM, main threats and vulnerabilities, and also popular cryptographic technologies and secure network protocols. ...

Еще в разделе: (Показать все результаты (>18) - hcs.cmc.msu.ru/ )

• Mathematical Models of Complex Systems: Theory, Algorithms, Applications |
• Master program "Mathematical Models of Complex Systems" | Магистерское и
• Master program "Enterprise Information Systems" | Магистерское и послевузовское

... 07.04.2016 (Thursday) Session 1 10:00-10:20 10:20-10:40 10:40-11:00 11:00-11:20 11:20-11:40 ­ ­ ­ ­ ­ (chairman ­ M. Stynes) N. Kopteva V. Andreev H.-G. Roos S. Franz, H.-G. Roos A posteriori error estimates for singularly perturbed reactiondiffusion problems on anisotropic meshes. ... Numerical solution of a singularly perturbed initial-boundary value problem with a Neumann condition for a parabolic equation. ... Boundary layer solutions to time-periodic singularly perturbed parabolic problems. ...

Еще в разделе: (Показать все результаты (>10) - math.phys.msu.ru/ )

• Department of Mathematics, Faculty of Physics, Lomonosov MSU

... О кафедре . ... Сотрудники . ... На кафедре работают 55 преподавателей и научных сотрудников, среди которых 13 профессоров и 19 доцентов, 17 сотрудников кафедры являются докторами и 36 - кандидатами наук. ... После окончания в 1985 году средней школы поступил на физический факультет МГУ. В 1994 году закончил аспирантуру кафедры математики физического факультета МГУ. С 1994 года сотрудник кафедры. ... A.V. Shchepetilov. ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>15) - matematika.phys.msu.ru/ )

... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... https://cs.msu.ru/node/1707 . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>14) - ani.cmc.msu.ru/ )

• Prof. Dmitry P. Kostomarov at the Differential Equations and Topology
• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the

... новости . блог . обзоры . ... библиотека . ... о проекте . Флогистон / ключевые слова (теги) / library . ... психология и интернет . социальная психология . общая психология . клиническая психология . психология труда и инженерная психология . педагогическая психология . ... мысли о... психология и юмор . новости психологии . ... каталог психологических организаций . ... библиотека по психологии . архив учебных материалов по психологии и смежным наукам . ...

Еще в разделе: (Показать все результаты (>127) - www.flogiston.ru/ )

. To see a Russian version of this page, click here . (Professor, Director of SAI. Graduated from the Moscow State University (MSU) in 1964, Ph.D. 1967, MSU, Dr. of Science 1975, MSU) . A member of IAU and EAS, IAU committees No 42, 27. Fields of interest: Stellar astrophysics, close binary systems, inverse problems in astrophysics. Send your mail to: cher@sai.msu.su .

Еще в разделе: (Показать все результаты (>13) - uranus.sai.msu.ru/ )

• Igor Antokhin
• Tatjana Khruzina

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>209) - ocl.sai.msu.ru/ )

. Please standby and you will be automatically connected to the new location of the unframed Supernova page. Or, click on the link above. If you have questions or problems, please email me at David Bishop dbishop@vhdl.org . Last modified: Mon Aug 27 12:40:15 EDT 2001

Еще в разделе: (Показать все результаты (>22) - www.rochesterastronomy.org/ )