SAI 175 anniversary . ... Moscow University . Search for in SAI Moscow University Search for in Russian astronomical resources . ... SAI Astronomical Databases . ... Browse SAI Software archive(ftp.sai.msu.su) . ASTRONET.RU - Russian Astronomical Network (available in translit also) . ... SAI Supernovae Research Group . ... Department of the Galaxy and Variable Stars (in Russian) . Sternberg Astronomical Institute Seminars . ... All-Russian Astronomical Olympiad (in Russian) . ...

Еще в разделе: (Показать все результаты (>2521) - www.sai.msu.su/ )

Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics . ... Links . ... CDFE => Links . ... Space Physics Online Data Services at MSU SINP . Japan Atomic Energy Research Institute Nuclear Data Center . Korean Atomic Energy Research Institute Nuclear Data Center . MacNuclide Nuclear Data Base Management System . ... Radiation Safety Information Computational Center , Oak Ridge National Laboratory . ... Los Alamos National Laboratory Nuclear Data Viewer . ...

Еще в разделе: (Показать все результаты (>4931) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page
• CDFE => Online Services
• CDFE => Team

S .. ... a database of structures of DNA-protein and RNA-protein complexes. ... a program for finding hydrophobic clusters in 3D structures of macromolecules . ... search of conserved hydrophobic clusters in aligned 3D structures of protein families . ... a program for analysis of multiple alignments . ... a program for automatic detection of aligned blocks in a multiple protein alignment. ... a program for detection of aligned blocks in a multiple alignment of sequences of PDB chains. ...

Еще в разделе: (Показать все результаты (>2285) - monkey.belozersky.msu.ru/ )

• Molecular biology databases

Электронная библиотека Попечительского совета . ... Brown S.M. - Bioinformatics: A Biologist's Guide to Biocomputing and the Internet . ... Название: Bioinformatics: A Biologist's Guide to Biocomputing and the Internet . Автор: Brown S.M. Аннотация: . A practical overview of bioinformatics, for researchers. ... Also discusses and evaluated programs for PCs, the Internet, and mainframes. DLC: Bioinformatics. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>20366) - lib.mexmat.ru/ )

• Журнал Lecture Notes of the Institute for Computer Sciences, Social-Informatics
• Журнал Lecture Notes in Computer Science :: Электронная библиотека
• Andersen K.V., Debenham J., Wagner R. - Lecture Notes in Computer Science

... Staff . ... Doctor of Physics and Mathematics, Professor Head of the Laboratory of Nonlinear Analysis and the Design of New Types of Vehicles at Udmurt State University . Leading Researcher at Steklov Mathematical Institute RAS . Senior Researcher of the Department of Theoretical Mechanics at Moscow Institute of Physics and Technology . ... Professor of Department of Theoretical Physics at UdSU . ... Researcher of Laboratory of Computer Physics of Department of Theoretical Physics at UdSU . ...

Еще в разделе: (Показать все результаты (>218) - ics.org.ru/ )

• Institute of Computer Sciences - Staff - Mamaev Ivan Sergeevich
• Institute of Computer Sciences - Staff - Borisov Alexey V
• Institute of Computer Sciences - Journals

Computer tool for gene expression data processing and correlation analysis Anastasia M. Spitsina, Novosibirsk State University, 630090, Novosibirks, 2 Pirogova Str. , anastasia.spitsina@gmail.com Natalya ... databases (BioGPS (http://biogps.org/), GEO NCBI (http://www.ncbi.nlm.nih.gov/geo/)) has accumulated a large body of experimental data obtained using DNA microarrays ... So the aim of this work was to develop and improve own program for data processing and analysis of gene expression. ...

Еще в разделе: (Показать все результаты (>367) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/42.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/39.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/68.pdf

... Science . ... 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . ... Main Science and education Scientific Laboratories Laboratory of computer simulations in optics . ... Dergachev Aleksandr Aleksandrovich engineer, Ph.D. Dormidonov Aleksandr Evgen'evich Ph.D. Kandidov Valeriy Petrovich professor, Doctor of science . ... Femtosecond Nonlinear Optics of High Power Laser Radiation . Femtosecond TW Laser Pulse Filamentation in Gases and Condensed Media . ...

Еще в разделе: (Показать все результаты (>114) - ofvp.phys.msu.ru/ )

... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>278) - www.genebee.msu.ru/ )

• GeneBee
• The Russian EMBnet Node
• Notes on searching by similarity

... I was born on February 15, 1971 in Moscow (Russia). From 1988 to 1994 I was a student of the Faculty of Physics of Moscow State University . From 1994 to 1997 I was a Post-graduate student of the Faculty of Physics of Moscow State University . From 1997 I am working for the Division of Theoretical High Energy Physics of the Skobeltsyn Institute of Nuclear Physics of Moscow State University as a scientific collaborator. ... QFTHEP'2001 (Moscow) . ... with my cat Piso . my cat Piso . ...

Еще в разделе: (Показать все результаты (>15362) - theory.sinp.msu.ru/ )

• Seminar on Computer Algebra in 16 January 2002
• [Computer_algebra] CA Seminar on Wednesday, April 16
• Quantum Computer

The Chair of Mathematical Theory of Intelligent Systems and . Laboratory of Problems of Theoretical Cybernetics . ... MaTIS Chair . ... Research . ... Computer Solver . ... development of computer teaching systems . Information Monitoring . creating the systems of information monitoring . Search in Databases . systems of fast search in extensive databases . ... The Chair of Mathematical Theory of Intelligent Systems, Laboratory of Problems of Theoretical Cybernetics . ...

Еще в разделе: (Показать все результаты (>172) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: Computer Solver
• Intelligent Systems :: Research :: Computer Teacher
• Intelligent Systems :: Research :: :: Demos

News . ... International Symposium "Information Systems and Web-portals on Biodiversity of Species Ecosystems" . ... We invite you to take part in the International Symposium 'Information Systems and WEB-portals on Biodiversity of Species Ecosystems' which will be held in Borok, Yaroslavl province, Russia, November 28 th to 1 st December, 2006. ... Pavlov D.S. - Director of Severtsov Institute of Ecology Evolution RAS, Moscow . ... A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS) ...

Еще в разделе: (Показать все результаты (>2815) - www.sevin.ru/ )

• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News: News: II
• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News
• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): Site News: Site

... Государственный Астрономический Институт имени П.К. Штернберга МГУ . ... Семинары ГАИШ . ... Государственный астрономический институт им. П.К.Штернберга (ГАИШ) научно-исследовательский институт, являющийся одним из подразделений МГУ им. М.В. Ломоносова . ... 11 декабря 2006 года исполнилось 175 лет со дня создания на Пресне Астрономической обсерватории Московского университета, ставшей впоследствии базой для формирования Государственного астрономического института им. П.К. Штернберга (ГАИШ МГУ). ...

Еще в разделе: (Показать все результаты (>114) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Description

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>32) - mouse.genebee.msu.ru/ )

... Master Education . ... Master programs . ... The educational programme aims to prepare the graduates for activities requiring in-depth fundamental and professional knowledge, including research in applied mathematics and computer technology, development and use of mathematical models for processes and objects, development and application of advanced mathematical methods and software to address problems in science, technology, economics and management.The Software for Computer Networks ...

Еще в разделе: (Показать все результаты (>28) - hcs.cmc.msu.ru/ )

• Master program "Mathematical and computer methods of image processing" |
• The core courses for the specialty "Applied Mathematics and Computer Science".

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>27) - dbserv.sinp.msu.ru/ )

Laboratory for Neurophysiology and Neuro-Computer Interfaces . ... EEG Records Databases [ <<< ] . ... EEG Database Description . The description will be available soon. Download related paper - [ PDF ] . ... We gratefully acknowledge Ph.D. S.L. Shishkin (Head of the Laboratory for Neuroergonomics and Brain-Computer Interfaces at Kurchatov NBICS Centre, National Research Centre "Kurchatov Institute") for research design and supervision. Download Database: . ...

Еще в разделе: (Показать все результаты (>85) - brain.bio.msu.ru/ )

• EEG Databases Links
• Sergei Shishkin * Сергей Шишкин
• Links -- Laboratory for Neurophysiology and Neuro-Computer Interfaces (MSU,

... 18 27 апреля 2016 года . ... СЕМИНАР ПО МЕХАНИКЕ СПЛОШНЫХ СРЕД . В среду, 13 апреля 2016 г., в кинозале Института механики МГУ в 12.00 состоится очередное заседание семинара по механике сплошных сред под руководством А.Г. Куликовского, В.П. Карликова и О.Э. Мельника. ... версия для печати 2016-04-07 . ... 260 заседание семинара ?Физико-химическая кинетика в газовой динамике? состоится в четверг 07 апреля 2016 года (11 часов, кинозал Института механики МГУ) . ... НИИ механики МГУ, 2002 2016. ...

Еще в разделе: (Показать все результаты (>4) - www.imec.msu.ru/ )

ITPM MSU . Quantum Computing Page . ... Quantum Computation/Cryptography at LosAlamos . Quantum Information at Los Alamos National Laboratory . Laboratory for Theoretical and Quantum Computing ( Universite de Montreal ) . Quantum information and quantum computation at IBM . ... Centre for Quantum Computation . Quantum Information Page . Quantum Information and Computation . ... Quantum Information and Quantum Computing (by Reinhard F. Werner) . ... c) ITPM MSU 1998, 1999 ...

19. Laboratory of Informatics

20. Computers and Geosciences - журнал | ИСТИНА - Интеллектуальная Система