CATALOGUE OF SPACE STORMS . based on the list of selected geomagnetic disturbed days with mean daily Ap>20 in 1997-2009 . ... Description of the Catalogue . NN - number of event . ... 3d Map of Solar Events - Map of the solar events on the solar surface (see Map description ) occurred from four to two days before the geomagnetic disturbed day . 3d List of Solar Events - Solar Events occurred from four to two days before the geomagnetic disturbed day (obtained from Solar Event Reports ). ...

Еще в разделе: (Показать все результаты (>18) - dbserv.sinp.msu.ru/ )

• BAFIZ

MSU . Science Park . ... 2-4 June 2014, Moscow hosted the Third International Summit of technology parks and business incubators "Technoparks as new drivers of national economic development." ... To do this for three days at the III Summit held an educational seminar "Managing effective business incubators and technology parks" with American colleagues - Heads of existing industrial parks and technology transfer centers. ... JSC MSU Science Park. ...

Еще в разделе: (Показать все результаты (>15) - www.sciencepark.ru/ )

• MSU Science Park - Companies
• MSU Science Park - Projects & Partners
• MSU Science Park - Publicity

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Technological Institute for Superhard and Novel Carbon Materials . ... Therefore, in solving the problems will be applied as specialized methods for the study of polyatomic structures - the method of empirical potentials Brenner . ... AREA: Condensed Matter Physics, Theoretical Physics, Physical Chemistry . ... Moscow State Uiversity . ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>60) - hpc.msu.ru/ )

• APPLICATIONS: Optics and Quantum Electronics | Moscow University Supercomputing
• APPLICATIONS: Plasma Physics | Moscow University Supercomputing Center
• APPLICATIONS: Engineering Sciences and Mechanical Engineering | Moscow

Laboratory of Ecobiocatalysis . ... Head of the laboratory: Ph.D., D.Sc., prof. Efremenko Elena N. Affiliation and official address: . Chemical Enzymology Department, Chemical Faculty . ... E-mail: efremenko@enzyme.chem.msu.ru . Laboratory employees . ... senior researcher . ... The development of biocatalytic systems and processes based on them to solve different biotechnology tasks in ecology field. ... Processes of detoxification of toxic compounds and their products of biodegradation; . ...

Еще в разделе: (Показать все результаты (>161) - www.enzyme.chem.msu.ru/ )

• Gudkov D.A.
• About Lab
• Efremenko E.N.

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ Recommendations of the International Workshop "Local Tsunami Warning and Mitigation" Petropavlovsk-Kamchatskiy, Russia, September 10 - 15, 2002 Analysis of the state-of-the-art of the local tsunami participants testifies to the potential of a significant methodology and hazard reduction. ...

Еще в разделе: (Показать все результаты (>25) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E09_Karlik.pdf

... About hotel . ... GET A VISA INVITATION . ... New laundry. In hotel there is a laundry for convenience of guests. ... Renewed website. The hotel т??69th Parallelт?? is glad to present its renewed website which now has an option of online booking! Feel free to share your opinion about us ... iVisa.ru т?? russian visa online service. ... Reception: +7(8152) 253-700 . 7 (8152) 253-700 . ... Online booking . All rights Reserved 2009-13 Т? Hotel Т?69 ParallelТЛ . ...

Еще в разделе: (Показать все результаты (>8) - 69parallel.ru/ )

University Satellites and . Space Science Education . ... The purpose of the developed scientific - educational program complex is creation on the Earth on the base of telemetry data of virtual model of microgravitational environment in which experiments are carried out, and virtual motion model of of the space vehicle. ... The developed program complex concerns to the class of the distributed program systems. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>6710) - cosmos.msu.ru/ )

• UNIVERSAT-2009: University Satellites in Space Sciences Education, Zvenigorod,

Chair of General Physics and Wave Processes, Physics Faculty of MSU . ... Science and education . ... Grants . Science . ... Education . 20.09.2009 . 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . Moscow Vyatichi, November 9 - 11, 2009. ... Happy New Year 2012! Main Grants . ... Russian Ministry of Science and Education . ... Zapunidi Sergey A. Start year . ... 2009 Chair of GP and WP, physical department Made in: Sebekon IT Solutions . ...

Еще в разделе: (Показать все результаты (>776) - ofvp.phys.msu.ru/ )

• Grants

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... The present study aims at developing and testing a new generation of sensor materials based on the whiskers of n-type ZnO and SnO2 and immobilized on the surface of oxide clusters p-type CuO, NiO, PdO, to solve the problem of increasing the sensitivity , selectivity and speed sensor materials to toxic and explosive products in the air. ...

Еще в разделе: (Показать все результаты (>61) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and semiconductor materials |

CURRICULUM VITAE SERGEY BALAKHONOV Lomonosov Moscow State University (MSU) Department of Materials Science , Inorganic Chemistry Division Laboratory MSU, Leninskie Gory 1/3, GSP-1, Moscow , 119991, Russia Name Born Nationality Age Marital state Home address Phone number Fax number E-mail Web Sergey Balakhonov 26.09.1987 in Bryansk, Russia Russian Federation 23 years old Unmarried 119991, ... Hydrothermal / solvothermal and hydrothermal-microwave synthesis. ...

Еще в разделе: (Показать все результаты (>77) - www.inorg.chem.msu.ru/ )

• Inorganic Supramolecular Assembl
• PhDs (since 1995):

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>2) - www.edst.msu.ru/ )

... Recently we described a novel method for forming substrate-supported macroscopically-aligned lipid bilayers by self-assembling phospholipids into nanotubular structures inside ordered nanochannels of anodic aluminum oxide (AAO) [1]. We have also shown that these nanotubular bilayers retain many properties of unsupported bilayers and are suitable for incorporating transmembrane peptides and small membrane proteins [2]. ... 2007 Biophysics dep., ...

Еще в разделе: (Показать все результаты (>76) - www.msm.biophys.msu.ru/ )

... Магистерское образование . ... Enterprise Information Infrastructure . This course is focused on enterprise infrastructure and integration technology. Course presents different approaches to enterprise architecture and modern solutions of information infrastructure problems. Course?s topics cover strategies that help large enterprises to increase the agility of their IT systems. ... Enterprise portal technology, including collaboration and knowledge management . ... FI- Master data . ...

Еще в разделе: (Показать все результаты (>24) - hcs.cmc.msu.ru/ )

• Master program "Information Security and Cryptography" | Магистерское и

... Joining of Approximate Asymptotic Groups for Some Model Examples . ... We have considered some ordinary differential equations with a small parameter by the higher derivatives (the van der Pol equation and the Stokes-Oseen problem). ... Here we try to apply the method of joining of asymptotic expantions in the theory of approximate group analysis. For the considered problem we offer an algorithm of joining asymptotic expantions of approximate groups. ...

Еще в разделе: (Показать все результаты (>280) - acs366.phys.msu.su/ )

• Abstract (Invited)

... This course is dedicated to the main principles, methods and techniques of parallel programming oriented at resolution of resource-intensive tasks physically and in non-linear optics in particular. The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... Antonov, A.S. Parallel Programming Using MPI. ...

Еще в разделе: (Показать все результаты (>92) - engineering.phys.msu.ru/ )

• Introduction to Linux

Roman Sutormin rsutormin@gmail.com Professional experience 05/2013 ­ present: Lawrence Berkeley National Laboratory (Berkeley, CA, USA) Software developer Development of JSON based storage system used for keeping biological data involved in public KBase services. ... 10/2009 ­ 08/2011: Mail.Ru Group (Moscow, Russia), Software developer Support and development of data warehouse (PostgreSQL) and administration web tool (JBoss + GWT) on serverside of MMO game "Allods Online". ... 2013 Jul 1514(1):476. ...

Еще в разделе: (Показать все результаты (>11) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2013.pdf

HERMITE FUNCTIONS EXPANSION BASED NON-LOCAL MEANS ALGORITHM FOR CT-APPLICATIONS1 N. Mamaev2, A. Lukin3, D. Yurin4, M. Glazkova5, V. Sinitsin6 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia mamaev.nikolay93@mail.ru, 3lukin@ixbt.com, 4yurin@cs.msu.ru 5,6 Federal Center of Medicine and Rehabilitation Ivan'kovskoye sh., ... Noise in CT-images is close to Gaussian [3]. ...

Еще в разделе: (Показать все результаты (>20) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2013.PRIA.Levashov_Yurin.RidgeAndTree.en.pdf

... Snecma Moteurs (Groupe Snecma, France) . ... The Colloquium-458, organized by EUROMECH , will take place at Institute of Mechanics of Lomonosov Moscow State University (MSU) . ... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... France. ... S.-Petersburg State Techn. ...

Еще в разделе: (Показать все результаты (>3) - www.imec.msu.ru/ )

• "Advanced Methods in Validation and Identification of Nonlinear Constitutive

... DEPRON device (Dosimeter of Electrons, PROtons and Neutrons) is intended for the measurements ofљ the absorbed doses and linear energy transfer spectra from high-energy electrons, protons and nuclei of space radiation, and for detecting of thermal and slow neutrons flux. ... Charged particles dosimeter based on semiconductor detector . ... For each detected particle an amplitude of impulse proportional to the energy lost by the particle in the detector?s track sensitive volume is registered. ...

Еще в разделе: (Показать все результаты (>58) - lomonosov.sinp.msu.ru/ )

• IMISS-1 | Университетский спутник "Ломоносов"
• Scientific equipment | Университетский спутник "Ломоносов"