... 001.89:004 .. , .. , .. , .. , .. , .., .. e-mail: kryukov@theory.sinp.msu.ru RESTFUL-- 2012-4/882 RESTful-- , : , , , UNIDATA Common Data Model, , , , , , . ... NCEP/NCAR [1], , ). , . ... RESTful-- , : , , , UNIDATA Common Data Model [2], , , , , , . ... UNIDATA Common Data Model (CDM) [2]. ... UNIDATA CDM 3. ... XML . ... Unidata Common Data Model. : http://www.unidata.ucar.edu/software/netcdf-java/CDM/ [3]. ... Network Common Data Form (NetCDF). : http://www.unidata.ucar.edu/software/netcdf/ [5]...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

... REVIEWS Measurement and Physical Content of Quantum Information B. A. Grishanin and V. N. Zadkov Received January 15, 2002 Abstract--Basic quantum information measures involved in the information analysis of quantum systems are considered. ... But today, it has become possible to intentionally vary directly quantum states of elementary quantum systems. ... 9 2002 MEASUREMENT AND PHYSICAL CONTENT OF QUANTUM INFORMATION 935 its information-equivalent copy is at the input and output. ...

Еще в разделе: (Показать все результаты (>74) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/LasPhys10_03GrishaninLO.pdf
• http://qilab.phys.msu.ru/people/grishanin/teaching/program.pdf
• http://qilab.phys.msu.ru/papers/LasPhys-2000-10(6)-en.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus
• Align tool for DNA-protein complexes

... You have to choose only one answer among the suggested options; for tasks 1-4 write down `agree' beside the answer you choose. ... Peptide bond between amino acids in a molecule of protein is underlaid by: a) b) c) d) the principle of complementarity; insolubility of amino ac ids in water; solubility of amino acids in water; the presence of carboxy and amino group; Task 2. ... There are ten cards, each with one side white and one side black. ... What is your understanding of the word "progress"? ...

Еще в разделе: (Показать все результаты (>164) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/science/psyrussia/2009/podolskij.pdf
• http://www.psy.msu.ru/science/psyrussia/2009/petrenko.pdf
• Psychology in Russia. Distribution

... April 2, 1999 . Stars of NGC 206 . ... Explanation: Nestled within the dusty arms of the large spiral galaxy Andromeda (M31), the star cluster NGC 206 is one of the largest star forming regions known in our local group of galaxies. The beautiful bright blue stars of NGC 206 betray its youth - but close, systematic studies of variable stars in and around NGC 206 will also accurately reveal its distance. ... About APOD > . ...

Еще в разделе: (Показать все результаты (>132) - www.arcetri.astro.it/ )

• APOD: 2000 March 20 - Mercury on the Horizon
• APOD: 2000 December 15 - IC443's Neutron Star
• APOD: June 5, 1999 - Betelgeuse, Betelgeuse, Betelgeuse

This page briefly describes the texture filtering modes implemented in the current release of PolyWorld Engine. The following is a sample MIP-map texture generated from a regular 256x256 texture map. ... This map is usually referred to as a 4D Pyramid Anisotropic Filtering map. Only one, isotropic integer MIP level is calculated (MIP u = MIP v ). ... Unlike the Bilinear Filtering case shown above, rational isotropic MIP level is calculated . ... color = lrp (color1, color2, frc_MIP); . ...

Еще в разделе: (Показать все результаты (>28) - www.kge.msu.ru/ )

• Software Shaders

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>27) - observ.pereplet.ru/ )

• Candidate Assignments

... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 ­ 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...

Еще в разделе: (Показать все результаты (>8) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./ulrich.pdf

V. V. KOZLOV Department of Mechanics and Mathematics Moscow State University, Vorob'ievy Gory 119899, Moscow, Russia E-mail: vako@mech.math.msu.su KINETICS OF COLLISIONLESS CONTINUOUS MEDIUM Received June 8, 2001 DOI: 10.1070/RD2001v006n03ABEH000175 In this article we develop Poincarґ ideas about a heat balance of ideal gas considered as a collisionless continuous medium. e We obtain the theorems on diffusion in nondegenerate completely integrable systems. ... d3 2 2 For the Maxwell distribution = 1. ...

Еще в разделе: (Показать все результаты (>123) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/daf/135-on-justification-of-gibbs-distribution_ru.pdf
• http://ics.org.ru/upload/iblock/d40/126-galton-board_ru.pdf
• http://ics.org.ru/upload/iblock/972/RCD752.pdf

. О кафедре . Сотрудники . Учебная работа . Темы курсовых работ . Научная работа . Материалы . А.А. Лазарев . Ю.В. Митришкин . љ . Главная . Features . Layouts . UIkit . Widgetkit . Icons . ZOO . Joomla . Content views . Featured Articles . List All Categories . Category List . Other views . Contacts . Web Links . Login . Tags . Главная . escort beylikduzu bayan escort escort bayan escort escort istanbul escort bayan porno film escort istanbul escort beylikduzu escort bayan

Еще в разделе: (Показать все результаты (>35) - physcontrol.phys.msu.ru/ )

• Features
• Featured Articles
• Widgetkit

Preconcentration Laboratory . Laboratory of Chromatography . ... Laboratory of Kinetics Methods of Anaysis . ... Sorption-spectroscopy methods for determination of organic . ... Room-temperature ionic liquds, computational chemistry . ... New detection methods in ion and ion-pair chromatography . ... For that purpose, methods of selective preconcentration are developed along with the methods of determination of analytes directly in the sensing film or in the permeate after membrane diffusion. ...

Еще в разделе: (Показать все результаты (>27) - analyt.chem.msu.ru/ )

... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2396.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>8) - lvk.cs.msu.su/ )

... QUANTUM INFORMATION AND COMPUTATION Absolute Robustness of the First Principal Fourier State Component and Noise Suppression in Hilbert Space Yu. ... 2, Moscow, 119992 Russia e-mail: skulik@qopt.phys.msu.su Received March 28, 2006 Abstract--The effect of the absolute robustness of the first principal Fourier-state component is developed upon rounding off the density matrix elements. ... This is interpreted as the absolute robustness of the first principal component of the Fourier state density...

Еще в разделе: (Показать все результаты (>95) - qi.phys.msu.ru/ )

• http://qi.phys.msu.su/papers/2007-os(e)-103-107.pdf
• http://qi.phys.msu.ru/papers/2010-prl-105-010404.pdf
• http://qi.phys.msu.ru/papers/2013-njp-15-073016.pdf

BIGRADED BETTI NUMBERS OF CERTAIN SIMPLE POLYTOPES IVAN LIMONCHENKO There is a well-known in toric topology construction which associates a smooth manifold with a combinatorial simple polytope. ... In the common case, according to what is mentioned above, while considering the 4 cases, we obtain the following: ~ ~ dimk Hi (KW , k ) = dimk Hi (K W -{v } , k ) = 0; BIGRADED BETTI NUMBERS OF CERTAIN SIMPLE POLYTOPES 5 From our observations it is easy to see, that the following takes place Corollary 3.3. ...

Еще в разделе: (Показать все результаты (>154) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/TTC/slides/kamiyama.pdf
• http://higeom.math.msu.su/people/ssmirnov/astana.pdf
• http://higeom.math.msu.su/people/taras/mypapers/umn-s99e.pdf

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>150) - hist.msu.ru/ )

• Toleration and Persecution. Christian Attitudes to Jews and Judaism in "Latin"
• Department of Foreign Languages
• Discrimination and the Labor Market in the Oil Industry in Baku

FAQ: QUESTIONS ASKED BY NOVICE USERS (c) Australian Geological Survey Organisation 1999-2002 (c) Yuri Shvarov 1999-2002 Last updated: 3 May 2002 This file does not substitute for the comprehensive HCh documentation. ... 2 UNITHERM USAGE 2.1 UNITHERM DATABASE 2.1.1 What is the guaranty that the included UNITHERM database has no incorrect entries? ... User's Guide. ... You can speed up your calculations for aqueous systems in a "manual" calculation mode of GIBBS when using Blank or Input files. ...

Еще в разделе: (Показать все результаты (>72) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/geochems/soft/en/2008.pdf
• http://www.geol.msu.ru/deps/geochems/soft/en/GibbsLib.doc
• http://www.geol.msu.ru/deps/geochems/soft/en/Unitherm.doc

... On the Geological and Physical Mechanisms of Natural Processes in Dynamic Geology Problems N. V. Koronovskii, A. A. Naimark, V. S. Zakharov, and G. V. Bryantseva Department of Geology, Moscow State University, Moscow, Russia e mail: koronovsky@rambler.ru, fnaim@ya.ru, vszakharov@yandex.ru, bryan@geol.msu.ru Received March 30, 2015 Abstract--The applicability of the abstract physical mechanisms in studies of concrete geological processes is considered. ... MOSCOW UNIVERSITY GEOLOGY BULLETIN Vol. ...

Еще в разделе: (Показать все результаты (>21) - dynamo.geol.msu.ru/ )

• V.Zakharov's Ph.D. thesis
• Publications of V.Zakharov

... Five Key Advantages of Online Banking . ... Most online banking systems feature this capability, allowing for you to enter in your account information for your billers, to pay them directly from your bank account. ... However, you may have the funds needed in another account such as a savings account. One of the advantages of online banking is the ability to transfer funds from one of your accounts to another. ... The advantages of online banking are increasing every year. ...

Еще в разделе: (Показать все результаты (>112) - elana.sinp.msu.ru/ )

• cheap michael kors Cyclacel Pharmaceuticals? CYCC CEO Spiro Rombotis on Q2 2015
• michael kors outlet uk The following diets will be discussed | С Днем Победы!
• cheap moncler jackets Eagle Broadband Picks Terremark NAPEagle says it selected

. [ Войти ] . Главная -> Фильмы -> Just Follow Law: Wo zai zhen.. Пользователи . Демо . Деньги . Фильмы . Форум . Just Follow Law: Wo zai zheng fu bu men de ri zi . Сингапур 2007 . отметить . Комедия . Драма . Фэнтэзи .

Еще в разделе: (Показать все результаты (>193) - kinfo.ru/ )

• Follow the Prophet - Фильмы - Kinfo.ru
• Following the Rabbit-Proof F.. - Фильмы - Kinfo.ru
• Follow Me, Boys! - Фильмы - Kinfo.ru