... HOMETOPIC%][%HOMETOPIC%]] - try out Foswiki on your own * [[Sandbox.% TOPIC%Sandbox][%TOPIC%Sandbox]] - just for me * * ---++ My Personal Data Note: if personal data is being stored using a secret database, then it is only visible to the user and to administrators. ... My Personal Preferences Uncomment [[%SYSTEMWEB%.PreferenceSettings][preference settings]] to activate them (remove the #-sign). ... This topic: Main > WikiUsers > ArtemTimoshenko . ... Copyright by the contributing authors. ...

Еще в разделе: (Показать все результаты (>1897) - wiki.cs.msu.ru/ )

• (backlinks in Main Web) UserTools < Main < Foswiki
• (backlinks in all Webs) UserTools < Main < Foswiki
• (backlinks in all Webs) WikiUsers < Main < Foswiki

... RUBRRRIKA RUBRIKA Evolution of the Quantitative Measures of Quantum Information: on the Path to a Unified Theory of Quantum Information B. A. Grishanin and V. N. Zadkov Physics Faculty and International Laser Center, Moscow State University, Moscow, 119992 Russia e-mail: grishan@comsim1.phys.msu.su Received July 11, 2002 Abstract--The most general approaches to determining the quantitative measure of quantum information are analyzed based on physical content. ... with an arbitrary state | ...

Еще в разделе: (Показать все результаты (>77) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/Laser-Phys-Lett-2004.pdf
• http://qilab.phys.msu.ru/papers/JCTE-2002-en.pdf
• http://qilab.phys.msu.ru/papers/JETP-2000-91(5)-en.pdf

University Satellites and . Space Science Education . ... Abstract Submission List of submitted abstracts . ... The abstract you have submited . The role of reference frames in the analysis of physical problems. ... Basis are the examples of applied in physics analyses which require defining of the so called reference frames. For each process-phenomenon we try to find a proper reference frames. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>6705) - cosmos.msu.ru/ )

Geology at Moscow State University . ... Our adjunct Professors . ... The faculty permanently extends the contacts with many overseas universities. The graduator of 1991 Artem R. Oganov who completed his PhD degree in University of London and now works as a leader of the group in ETH (Zurich) was recently nominated by the Faculty Scientific Council as an adjunct Professor. Prof. Dr. Artem R. Oganov . ... 2) Adjunct Professor, Geology Department, Moscow State University, Moscow 119899, Russia. ...

Еще в разделе: (Показать все результаты (>77) - www.geol.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out

... Lectures, Questions & Answers . ... Evgeny V. Antipov (Faculty of Chemistry, Moscow State University) New cathode materials for lithium batteries . Questions and Answers . ... Questions . Vladimir I. Feldman (Faculty of Chemistry, Moscow State University) Physics and chemistry of solvated electron . ... Galina A. Tsirlina (Faculty of Chemistry, Moscow State University) Diversity of electrochemistry: the specific problems of molecular models and their experimental verification . ...

Еще в разделе: (Показать все результаты (>30) - www.elch.chem.msu.ru/ )

EXPERIMENTAL STUDY ON MELTING PHASE RELATIONS AND DIAMOND FORMATION IN THE CARBONATE-RICH KIMBERLITE FROM MAJUAGAA, . ... Carbonate-rich hypabyssal kimberlites of the Majuagaa dyke, Maniitsoq , southern West Greenland could be roughly characterized as a mixture of olivine and ilmenite (or Ti-magnetite) xenocrysts with the carbonate-rich (calcite and dolomite) matrix [1]. ... Subtraction of olivine and ilmenite results in a composition, which is close to carbonatite rather than carbonate-silicate melt. ...

Еще в разделе: (Показать все результаты (>694) - geo.web.ru/ )

• KRANTZ, THE OLDEST MINERAL DEALER IN GERMANY,
• Abstract

The XIIIth International Conference Cognitive Modeling in Linguistics (CML ­ 2011) Corfu, Greece September 22 ­ 29, 2011 _____________________ CALL FOR PAPERS _____________________ General Information Conferences of the series "Cognitive Modeling" have been successfully held since 1998. ... From 2003 to 2007 CML conferences took place in Bulgaria (Varna and Sofia). ... Conference Location The XIIIth International Conference "Cognitive Modeling in Linguistics" (CML­ 2011) will be held on Corfu, Greece. ...

Еще в разделе: (Показать все результаты (>395) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~rlc2004/files/rlc2004en.doc
• Conference to commemorate A.E. Kibrik :: МГУ :: Филфак :: ОТиПЛ
• Title: Russian Language Training via INTERNET. Internet-based educational

... Conformational Analysis of Boron-Containing Compounds Using Gillespie-Kepert Version of Molecular Mechanics . ... Abstract - Molecular mechanics force field for boron-containing compounds based on CHARMM parameters and Gillespie-Kepert (GK) model is developed. ... The force field provides an accurate description of experimental X-ray stereochemistries in a wide range of organoboranes, organoborate complexes with polyhydroxy compounds, mixed oligomers of boric acid and borates. ...

Еще в разделе: (Показать все результаты (>42) - analyt.chem.msu.ru/ )

... Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science invite you to take part in "VI Russian National School with International Participation on Muscle and Exercise Physiology "Systemic and cellular mechanisms in physiology of motor system". ... We invite scientists, post-grade students, residents and students to take part in School on systemic and cellular mechanisms in physiology of motor system. ...

Еще в разделе: (Показать все результаты (>8) - fbm.msu.ru/ )

The M.V. Lomonosov Moscow State University is organizing a traditional International Conference "BIOCATALYSIS-2007" in 17-22 June 2007 (preliminary dates were changed). ... Structure, catalytic mechanism and protein engineering of enzymes. ... EURO . ... In view of a limited number of ship cabin passengers, the Organizing Committee is asking to apply for participation at BIOCATALYSIS-2007 Conference, to send the Abstracts and to pay the Registration Fee not later than the deadlines indicated above. ...

Еще в разделе: (Показать все результаты (>149) - www.enzyme.chem.msu.ru/ )

• Recent reports on conferences
• Abstract

Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . You may download the latest source code distribution and install the period search service at your own web server. ...

Еще в разделе: (Показать все результаты (>2) - scan.sai.msu.ru/ )

... Loskutov, and E. V. Ryadchenko Presented by Academician A.R. Khokhlov April 22, 2005 Received April 26, 2005 The problem of the identification and biological significance of chromosome fragments and complete genomes is approached on the basis of the representation of a sequence of DNA nucleotides as a two-dimensional walk. ... However, as applied to DNA, functional and structural fragments of a chromosome may be distinguished by a typical walk "pattern" only for a sufficiently large number of units....

Еще в разделе: (Показать все результаты (>75) - chaos.phys.msu.ru/ )

• Activities

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . Head of the Laboratory, Dr.Sci., Prof. Alexander M. Gaskov . ... Development of semiconductor materials for gas sensors . ... Head of the Laboratory of chemistry and physics of sensor and semiconductor materials . ... A. Gaskov, M. Rumyantseva. ... Fe 2 O 3 :SnO 2 Nanostructured System as Semiconductor Gas Sensor Material. ... 2008-2010 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>41) - www.lssm.inorg.chem.msu.ru/ )

... Effective Presentations . ... Read the following abstract and summarize the main points . ... And on a personal level, the ability to move the audience can shape the trajectory of a manager's career. ... You may open the presentation with a joke to get the audience's attention. Even if you write out your entire speech beforehand, you'll undoubtedly work to sound informal and conversational, possibly posing a few questions directly to the audience throughout the talk. ... Subject / title of talk. ...

Еще в разделе: (Показать все результаты (>11) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков и регионоведения МГУ. Центр дистанционного

... Also during this work Dian drank a lot of tea with sugar, completed his description of urban and rural life (to the tunes of world-known musical "Notre-Dame de Paris"), wrote several poems about his dear friend GVR. ... Besides this project, Sergei A. Spirin with his colleague Andrew V. Alexeevski takes a very great part in different researches. Near their work room on the 3rd floor of the "A" laboratory building, near with the biological one, different colourful posters can be watched. ...

Еще в разделе: (Показать все результаты (>92) - monkey.belozersky.msu.ru/ )

• SCOP classification
• Homeodomain numeration assumed
• About this project

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>22) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc
• http://www.innovation.msu.ru/english/methodsforfinancingfourcompany.doc

International Symposium Quasifission Process in Heavy Ion Reactions Messina (Italy) November 8-9, 2010 First Circular Chairman : Giorgio Giardina ( Messina ) Co-Chairman: Avazbek Nasirov (Dubna) Co-Chairman: Sara Pirrone (Catania) Scientific Secretary: Giuseppe Mandaglio ( Messina ), and Alessia Di Pietro (Catania) Local Organizing Committee: Giovanni Fazio ( Messina ), Giorgio Giardina ( Messina ), Giuseppe Mandaglio ( Messina ), Marina Manganaro ( ...

Еще в разделе: (Показать все результаты (>215) - phys.msu.ru/ )

• http://phys.msu.su/upload/iblock/2a9/first%20circular%20conference_2009.pdf
• Сенсоры для окружающей среды, здоровья и безопасности: Современные материалы и

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>320) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Миланские ученые нашли путь к долголетию с помощью
• Клуб выпускников МГУ: CRISIS IN THEORETICAL PHYSICS: THE PROBLEM OF SCIENTIFIC
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>7) - www.issp.ac.ru/ )