pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>36) - ideas.msu.ru/ )

... Supercomputing Technologies in Science, Education and Industry Almanac Series . AlgoWiki: an Open Encyclopedia of Parallel Algorithmic Features . ... X-COM: Distributed Computing Software . SIGMA: Collective Bank of Tests on Parallel Computing . ... Every teacher can make up his own set of tests using the collective data bank or using his own questions. ... Universities participating: 20 . ... Tests held: 413 . ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>49) - hpc.msu.ru/ )

• Supercomputing Education Project | Moscow University Supercomputing Center
• Nationwide Supercomputing Education Project | Moscow University Supercomputing
• APPLICATIONS: Condensed Matter Physics | Moscow University Supercomputing...

... As a perfect bag of Hermes, it isn?t strange to determine it sold at $6,750. ... Didn`t suggest we don?t adore determine producer creative designers, . ... We will try our excellent to dig his worth come up with him merged properly making use of the brand, . ... I stated to plenty of folks that Christophe may be among the many most ideal one, . ... Leather: Handbags created by Hermes uses only animal skin. ... http://www.slcamera.it/every-man-adores-his-car/ . ...

Еще в разделе: (Показать все результаты (>92) - elana.sinp.msu.ru/ )

• ralph lauren outlet uk Health Benefits of Soft Water | С Днем Победы!
• is doing an amazing job at gucci. Everyone thought organization was gonna be
• cheap moncler uk Adaptive Shirts for Decreased Shoulder Range of Motion | С

О лаборатории . ... Лаборатория теоретической биофизики . ... This Python module parses Gaussian cube files, produced by quite a few QM software packages, and makes volume data available as numpy array as well as some associated properties. ... Нет комментариев " Gaussian Cube files loader " . ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>32) - erg.biophys.msu.ru/ )

• Lipid membrane MD modeling with GROMACS ERG Research Group: Лаборатория
• membrane ERG Research Group: Лаборатория теоретической биофизики

Школа танцев Грация-МГУ . ... Грация-МГУ::Форум Общение Общение . ... Вестник тирании . ... O'Rey . Apr 20 2012, 04:15 . Сообщение #1 . born to create drama . Астрологи объявили неделю кровавой тирании. ... Любой пользователь, упомянувший в течение Недели Кровавой Тирании анатомические особенности строения женского тела, будет забанен на хренадцать дней и обретет статус-сообщение 'Похотливая самка бабуина'. ... Цитата(O'Rey @ Apr 20 2012, 05:29) . ...

Еще в разделе: (Показать все результаты (>936) - grace.msu.ru/ )

• Плохой день - Грация-МГУ::Форум
• Вся правда про белку - Грация-МГУ::Форум
• Нормы не для нас - Грация-МГУ::Форум

. People on #C4ACTbE as of 18 Jan 2001 18:45 MSK . Nickname . Status . User@Host . C4ACTbEP . idle . This is me, the channel bot. XAM[c] . idle . u0948@mvs.imm.uran.ru . Igorek . idle . igorek@kronos.psu.ru . Berendeev . - . graffity@ts16-a82.dial.sovam.com . Created by quesedilla v3 via eggdrop This page is automatically refreshed.

Еще в разделе: (Показать все результаты (>6) - asa.guru.ru/ )

... Alexei Lidov.. ... The creation of sacred space as a form of creativity and subject of cultural history .. ... 91 Mikhail V. Bibikov Byzantine Eden: "time in space" .. ... 140 Svetlana Popovi The Byzantine Monastery: its Spatial Iconography and the Question of Sacredness .. ... 525 762 Milena Rozhdestvenskaya The Creation of Sacred Space in Medieval Russian Literature: apocrypha and chronicles .. ... 556 Vladimir V. Sedov The Sacred Space of the Medieval Russian Church: the Architectural Aspect .. ...

Еще в разделе: (Показать все результаты (>18) - imk.msu.ru/ )

• Институт мировой культуры МГУ

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>19) - mouse.belozersky.msu.ru/ )

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... Please enter your username or email address. You will receive a link to create a new password via email. Username or E-mail: . ... Password . ... Lost Password . ...

Еще в разделе: (Показать все результаты (>63) - lomonosov.sinp.msu.ru/ )

• News | Университетский спутник "Ломоносов"

... Research . ... Linguistic expeditions . ... Up to now the subjects to documentation were local dialects of Selkup, Ket, and Evenki. ... 1) creation and enlargement of multimedia computer archives of Selkup, Ket, and Evenki speech, which include sounding dictionaries and folklore texts and life-stories in audio, video, and graphic representation in local dialects of the surveyed villages; development of linguistic multimedia databases; . ... 8) research into the Selkup-Ket-Evenki language contacts; ....

Еще в разделе: (Показать все результаты (>16) - lcl.srcc.msu.ru/ )

MEIS : ­ 2007 ­ 3/802 537.9 538.975 P.N.Chernykh, G.A Iferov., ... S. Abo, S. Ichihara, T. Lohner, F. Wakaya, T. Eimori, Y. Inoue, M. Takai, Nuclear Instruments and Methods in Physics Research B237 (2005) 72. ... D.P.Woodruff, Nuclear Instr. and Methods in Phys. Research B256 (2007) 293. ... T.Gustafsson, H.C. Lu, B. W. Busch, W. H. Schulte, E. Garfunkel, Nuclear Instr. and Methods in Physics Research B183 (2001) 146. ... L.R. Doolittle, Nuclear Instr. and Methods in Physics Research B9 (1985) 344. ...

Еще в разделе: (Показать все результаты (>93) - danp.sinp.msu.ru/ )

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Higher School of Management and Innovation (Faculty of Lomonosov MSU) was founded in June 2006 by the Academic Council on the initiative of the Moscow State University Rector, academician V.A. Sadovnichiy and Chairman of the Board of Directors of JSFC "Sistema" V.P. Yevtushenko. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• Message from Victor Antonovich Sadovnichy - Rector of Lomonosov Moscow State
• MSU Higher school of management and innovation |
• Application for participation | MSU Higher school of management and innovation

... The given course consisting of lectures and seminars is aimed at teaching our students a whole range of measures, which allow quick and efficient faultfinding, functional testing, reliability testing of a device, find replacement for a faulty component at the modern technological level, fix a device, create a similar device even without the blueprints. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ...

Еще в разделе: (Показать все результаты (>17) - engineering.phys.msu.ru/ )

... The exercises cover the following areas: Session A covers three ways you can use ROOT: the command line, the script processor, and the graphical user interface (GUI). ... Session A: | ... Display |cern.ch/root/Atlfast.html| ... Use the ROOT command line . ... In a new session open the new ROOT file (altfast.root) and find the TFile method to print the compression factor: root[] TFile f("atlfast.root") root[] f.<TAB> 3: What is the size and compression factor of the generated file, atlfast.root? ...

Еще в разделе: (Показать все результаты (>64) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-04-Security1.pdf
• http://acat02.sinp.msu.ru/presentations/ivanchenko/iv.pdf
• http://acat02.sinp.msu.ru/presentations/tyupikova/doclad.doc

... MPI_Win_fenc win); A[rank] = 4; MPI_Win_fenc win); MPI_Put ( .. ... MPI-2 I/O: MPI - -, , - , MPI « » - , , . ... int MPI _File_close( MPI_File *fh) INOUT fh () , fh , fh, , MPI _FILE_CLOSE int MPI _File_set_view( MPI_File fh, MPI _ Offset disp, MPI_Datatype etype, MPI_Datatype filetype, char *datarep, MPI _Info info) I I I I I I N N N N N N OUT fh () disp () etype () filetype () datarep () info () int MPI _File_get_view( MPI_File fh, MPI _ Offset *disp, MPI_Datatype *etype, ...

Еще в разделе: (Показать все результаты (>8) - angel.cmc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...

Еще в разделе: (Показать все результаты (>8) - depository.msu.ru/ )

• Biological information | depozitariy
• Main grant | depozitariy

... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...

Еще в разделе: (Показать все результаты (>77) - music.genebee.msu.ru/ )

... Alexey Garber Moscow State University April 17, 2010 A. Garb er (MSU) Quasicrystals April 17, 2010 1 / 33 Ё This work is a joint work with Dirk Frettloh from Bielefeld University. A. Garb er (MSU) Quasicrystals April 17, 2010 2 / 33 Separated net Definition A subset A of metric space M is called separated net if for some constants r and R following condition holds: for every two points x1 , x2 A distance dM (x1 , x2 ) r and for every point y M dM (y , A) R . ...

Еще в разделе: (Показать все результаты (>145) - higeom.math.msu.su/ )

... О проекте . ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... The layout of beam-lines and experimental stations intended for the applications of the X-ray laser-electron generator to the investigation of the elemental composition, material structure and biological objects is discussed. ...

Еще в разделе: (Показать все результаты (>6) - miles.sinp.msu.ru/ )