Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...
... wwf 17 декабря 2004 17:19:27 . ... Отвечаю по индексу вегетации. ... В красной области спектра (0,6-0,7 мкм) лежит максимум поглощения солнечной радиации хлорофиллом высших сосудистых растений, а в инфракрасной области (0,7-1,0 мкм) находится область максимального отражения клеточных структур листа. ... Картирование по NDVI позволило четко отделить растительные от прочих природных объектов и проанализировать диапазон значений индекса вегетации. ... wwf mailto:wwf@olekma.sakha.ru . ...
. КОМПЬЮТЕРЫ . Решение астрономической задачи N тел на кластере из ГПУ (pdf) . Exploring weak scalability for FEM calculations on a GPU-enhanced cluster (pdf) . Using GPUs to Improve Multigrid Solver Performance on a Cluster (pdf) . ClawHMMER: A Streaming HMMer-Search Implementation (pdf) . Проект Folding@Home . Лаборатория Параллельных информационных технологий НИВЦ МГУ .
... Вычисление обратной функции нормального распределения вероятности. SF51R_c вычисляет значение x такое, что x 1/(2 ) 1/2 e - t*t / 2 dt = P , - где P - заданное значение вероятности (0 < P < 1). ... A.J.Strecok, On the Calculation of the Inverse of the Error Function, Mathematics of Computation, 22(101), 1968. real sf51r_c (real *p, integer *ierr) . ... ierr - . ... когда заданное значение вероятности p не принадлежит интервалу (0, 1); значение функции полагается равным 3.4e38. utsf12_c - . ...
... A Primer from the Reform of Personal Income Taxation in Russia Introduction. ... However, to use the welfare function one needs to aggregate individual preferences that can also be unknown. ... The derivations lead to the conclusion that the optimal marginal income tax rate is increasing as the elasticity of labor supply increases. ... In this paper we obtain the characteristics of the labor supply for different population groups to get the elasticities of labor supply with respect to a post tax...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf -- 233.1 Кб -- 06.07.2014 Похожие документы
... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...
... The Lectures Contents: Lecture one: Contemporary Historical and Political Background Part One: The Historical Stages of the Arab Political Development Part Two: The Nature of the Arab Political Systems and the Arab Modern Wars Lecture Two: The Middle East Scenario of Crisis and Conflict Part One: The Israeli/Palestine Crisis Part Two: The Superpowers' Role in the Arab Affairs Lecture Three: The Arab Modern Regional Politics Part One: The Arab Politics towards its Unitarian Movements. ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... СУНЦ МГУ . ... Краткая информация . ... Материалы экзаменов 1-го тура прошлых лет . ... Кафедры . ... Сотрудники . ... Кафедра химии . ... Сезонные школы СУНЦ МГУ . ... Олимпиадные сборы СУНЦ МГУ . Интернет-ресурсы СУНЦ МГУ . ... Заочная школа СУНЦ МГУ . ... Главная Подразделения Кафедры Кафедра химии Chemistry Chair . Chemistry chair of AESC MSU was founded at 13 November 1989 by professor of MSU Chemistry department Yu. ... Natalia Igorevna Morozova, docent, PhD (Chem.) ... Chemistry Chair . ...
... О UNИX . ... Неизменяемая страница . ... Другие действия: Показать разметку Вид для печати Сформатировать как Docbook Очистить кэш страницы ------------------------ Проверить правописание Похожие страницы Карта окрестностей ------------------------ Переименовать страницу Удалить страницу ------------------------ Подписать пользователя ------------------------ Очистить от спама Вернуть эту версию Страницы пакета Синхронизировать ... http://heap.altlinux.org/engine/FrBrGeorge/ALJCourses ...
... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...
... Working channel dimensions: length - 1200 mm, width - 300 mm, height - 30 mm; 50mm. Air velocity range in a working channel: 5-120 m/s with a step 0,1 m/s. Mass air rate: 0,2-1,3 kg/s . ... Model/flow temperature difference: up to 120C . ... Aerodynamic unit 'SAU-Siemens' was created to investigate heat exchange intensification on the surfaces with complex relief (dimples, grooves, etc) in flat channels at subsonic flow of working medium (air). ...
RIDGE AND TREE FEATURE DETECTION ON IMAGES A. Levashov 2, D. Yurin3 2, 3 1 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia 2 alexeylevashov89@gmail.com , 3yurin@cs.msu.ru In this article a new ridge detector with improved non-maxima suppression procedure in scale-space is proposed. ... The algorithm is tested on synthetic, landscape and medical images. ...
[
Текст
]
Ссылки http://imaging.cs.msu.ru/pub/2013.PRIA.Levashov_Yurin.RidgeAndTree.en.pdf -- 603.0 Кб -- 18.11.2013 Похожие документы
... The mo del is a directed dyadic acyclic graph. ... New vertexes are added one by one. The probability of this addition dep ends on the structure of existed graph. ... 4 (2 ) FIGURE 4: The probabilities of different variants to add a new vertex to the future in the step number 500. pij is the probability to add a new vertex to the outgoing external edges numbers i and j . Similarly, p is the probability to add a new vertex to the incoming external edges numbers and . ...
[
Текст
]
Ссылки http://temporology.bio.msu.ru/EREPORTS/krugly_an-example.pdf -- 690.9 Кб -- 27.02.2014 Похожие документы
... www.net.cmu.edu (Carnegie Mellon University, Pittsburgh, PA - English) - D . ... Washington, DC - English) - A* This site is a general network-troubleshooting utility; it runs BGP, ping, traceroute, and a number of other routing-related utilities. ... www.efrei.fr (Efrei's, Paris - French) - * Options for timeout, TTL, name resolution . ... English) . ... Each one has a link to a network information tool, which will do an nslookup, visual ping, 30-packet ping, or traceroute to it. ...
... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Higher School of Management and Innovation (Faculty of Lomonosov MSU) was founded in June 2006 by the Academic Council on the initiative of the Moscow State University Rector, academician V.A. Sadovnichiy and Chairman of the Board of Directors of JSFC "Sistema" V.P. Yevtushenko. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...