... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...
Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...
... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...
[
Текст
]
Ссылки http://physcontrol.phys.msu.ru/materials/aal/CV_Lazarev_2012.pdf -- 455.1 Кб -- 15.05.2014 Похожие документы
About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...
... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......
... Полная версия: Технические работы на сервере . Грация-МГУ::Форум > Общение > Другая жизнь . ... Apr 14 2011, 00:01 . ... сегодня весь день на сервере будут проводиться технические работы. ... Subject: Internet cleaning.....very important.. ... hours in order to allow us to clean it. ... Internet. ... Internet users has grown dramatically. ... to other sysops and Internet users as well. ... Internet users has grown dramatically. вопщем, очистка интырнетов это прекрастно во всех отношениях, ящитаю . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... B Dispatch: 30.1.04 Author Received: Journal: JEB CE: Kumar No. of pages: 12 PE: Sri doi:10.1111/j.1420-9101.2004.00705.x Human birthweight evolution across contrasting environments F. T H OMAS , * A . ... The model illustrates that optimal birthweight depends on which fitness-reducing risk locally predominates (somatic diseases, parasitic diseases or adverse environmental conditions). ... Growth in utero, blood pressure in childhood and adult life, and mortality from cardiovascular disease. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf -- 284.1 Кб -- 16.03.2009 Похожие документы
... CENTRE FOR PHOTONUCLEAR EXPERIMENTS DATA . Online Services | ... CDFE: Online Services . ... Coded (machine-retrievable) information . ... DATA . ... This appendix provides a listing of all information-identifier keywords, along with details about their use. ... The general format of the coding string consists of three major fields which may be preceded by a decay flag: ((decay flag)nuclide,half-life,radiation). ... Gives information on references that contain information about the data coded. ...
... A Chemically Decoupled Nucleus and Inner Polar Ring of the SBb Galaxy NGC 4548 O. K. Sil'chenko* Sternberg Astronomical Institute, Universitetskii pr. ... This nucleus, a probable circumnuclear disk coplanar with the global galactic disk, is embedded in the bulge whose stars are generally also young, T 4 Gyr, although they are a factor of 2.5 more metalpoor. ... O. K. Sil'chenko, Pis'ma Astron. ... It remains to assume that the gas at the center of NGC 4548 rotates in an inclined plane. ...
... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...
... About choir . ... Contacts . Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Bishop Tikhon opened the choir of Moscow State University in Vienna . Choir of Moscow State University spoke at the Vienna branch of the United Nations . ... Phone: +7 (495) 939-1862,+7 (495) 939-3563 . Post address: . 119234, Moscow, Leninskiyeљgory, 1 . Cultural center MSU,љAcademic choir MSU . ... Address: љLeninskiyeљgory, 1, Cultural center MSU, . ...
www.vovr.ru 1992 14 · 1 0 , 20 12 CHUCHALIN A., GERASIMOV S. THE COMPETENCES OF ENGINEER ING PROGRAMS GRADUATES: NATIONAL AND INTERNATIONAL STANDARDS The issues of modernization of criteria used by Association of Engineering Education of Russia i n public accreditation HEI's engi neeri ng education programs ar e analyzed in the paper. ... Key word s: Russian higher professional educati on reform, federal state educatio nal standards (FSES), FSES based HEI's undergraduate educational programs. ...
[
Текст
]
Ссылки http://www.umo.msu.ru/docs/projects/monitoring/eksp_analiz_oop_10_12.pdf -- 175.9 Кб -- 01.04.2013 Похожие документы
... 4, No. 5 (2006) 10331056 c Imperial College Press RECOGNITION OF TRANSMEMBRANE SEGMENTS IN PROTEINS: REVIEW AND CONSISTENCY-BASED BENCHMARKING OF INTERNET SERVERS NATALIYA S. SADOVSKAYA Institute for Information Transmission Problems, Russian Academy of Science Bolshoi Karetny per. ... Landolt-Marticorena C, Williams KA, Deb er CM, Reithmeier RA, Non-random distribution of amino acids in the transmembrane segments of human typ e I single span membrane proteins, J Mol Biol 229(3):602608, 1993. ...
... To efficiently cover 1 km detection volume it would be necessary to deploy % 104 photomultipliers whose main requirements are a relatively large photocathode area, high gain, low noise, low after pulse rate and good timing resolution for single photon detection, the exact values depending on the detector design. ... Instr. and Meth. ... We identified four different types of secondary pulse according to the following definitions: Pre-pulse: pulses arriving at 10-80 ns before the main pulse, Fig. ...
... Coordination of economic policies and convergence of economic performance are fundamental to the integration of national economies in the Community. ... When U.S. President Barack Obama enters his White House meeting with Israeli Prime Minister Benjamin Netanyahu on March 5 -- angling to dissuade Israel from attacking Iran's nuclear facilities -- there will be one seemingly mundane issue on his mind that he may be too uncomfortable to share with his guest: gasoline prices. ... 2004. ...
Diaspora 16:8 2007 Repatriation to a Totalitarian Homeland: The Aijnbiguous Alterity of Russian Repatriates from China to the USSR^ Laurie Manchester ' Arizona State University ' ' In the 1950s, approximately 100,000 Russians repatriated to the Soviet Union from China. It was the largest repatriation ever of Russians bom abroad. Many were the children of those who fied Russia following the defeat of the White Army in the Civil War, These voluntary repatriates were not persecuted upon repatriation, unlike
[
Текст
]
Ссылки http://www.spa.msu.ru/uploads/files/nautchnaja_dejatelnost/manchester_diaspora.pdf -- 2188.4 Кб -- 13.05.2015 Похожие документы
... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...