... Variables representing the environmental conditions were `food' and `infection'. ... APPENDIX 1 An example of optimal life -history traits values (for a = 1.7 and m = 0.9) t 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 ... 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 z Et 2.3 2.5 2.7 2.8 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 3.8 3.9 4.0 4.0 4.1 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 ...

Еще в разделе: (Показать все результаты (>32) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/1998_Repair_EvolEcol.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Longev_JEvolBio.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf

... Laboratory staff participate in the RFBR grant 14-01-00420-аА in 2014-2016. Laboratory staff participated in the RFBR grant 11-01-00523-аА in 2011-2013. ... A. Galstyan participated with poster . Poster . ... International Conference on Mathematical Modeling in Physical Sciences . ... International Conference on Mathematical Modeling in Physical Sciences, 2013, 1-5 September, Prague, Czech Republic . ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>9) - lmmqsp.sinp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• ConClus

О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...

Еще в разделе: (Показать все результаты (>3) - elast.math.msu.su/ )

First Russian Conference "OZONE AND OTHER ENVIRONMENT FRIENDLY OXIDANTS. ... 7-9 June 2005, Moscow . ... State of Art and Perspectives of Ozone Application for Water Treatment in Russian Federation . ... The foreign as well as the native ozonizers are used at these stations. ... State Univ. ... The report on the impulse corona ozonizer (Russian Scientific Centre 'Kurchatov Institute', 'NTC ECOS', Moscow) with ozone synthesized from the undrained air was presented to the participants of the Workshop. ...

Еще в разделе: (Показать все результаты (>31) - www.kge.msu.ru/ )

• Семинар "Озон и другие экологически чистые окислители" -
• PolyWorld Texture Filtering
• RightMark Memory Analyzer

... A Primer from the Reform of Personal Income Taxation in Russia Introduction. ... However, to use the welfare function one needs to aggregate individual preferences that can also be unknown. ... The derivations lead to the conclusion that the optimal marginal income tax rate is increasing as the elasticity of labor supply increases. ... In this paper we obtain the characteristics of the labor supply for different population groups to get the elasticities of labor supply with respect to a post tax...

Еще в разделе: (Показать все результаты (>17) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./briedis.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf

... Данный раздел информационного портала посвящен основным конференциям по тематике ПЛИС, проходящим как в мире, так и в России. FPGA 2010 - Eighteenth ACM/SIGDA International Symposium on Field-Programmable Gate Arrays. ReConFig'09 - 2009 International Conference on ReConFigurable Computing and FPGAs. ИКТМР-2009 . ... 2009 Symposium on Application Accelerators in High-Performance Computing (SAAHPC'09) . RAW 2009 . ... 5th International Workshop on Applied Reconfigurable Computing. ...

Еще в разделе: (Показать все результаты (>3) - fpga.parallel.ru/ )

• Журналы, посвященные реконфигурируемым системам

... The model was then employed to assess the dependence of the association rate constant on the dimensions of the lumen. ... This small (10.5 kDa) protein diffuses in the lumen, a relatively narrow closed space between the thylakoid membranes, oxidizing cytochrome f (Cyt f ) in the membrane complex and then reducing the PS I reaction center. ... However, these works did not consider the diffusion of Pc molecules in the thylakoid lumen or their interaction with the b6 f and PS I membrane-bound complexes...

Еще в разделе: (Показать все результаты (>22) - www.library.biophys.msu.ru/ )

• МОДЕЛИРОВАНИЕ ВЗАИМОДЕЙСТВИЯ МАГНИТНОГО ПОЛЯ С ОБЪЕМНЫМИ ВЯЗАНЫМИ СТРУКТУРАМИ
• MECHANISMS OF THE ACTION OF A LOW-FREQUENCY MAGNETIC FIELD ON THE INITIAL

Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...

270. http://library.biophys.msu.ru/PDF/3347.pdf

271. http://osk.msu.ru/forum/members/aaplicagf.1452/?_debug=1

272. Best search engines for finding scientific information in the Internet:

273. http://muscle.imec.msu.ru/Pusch_ru.doc

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда