... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>9) - iconolat13.phys.msu.ru/ )

• Symposia

... Студенческая Астрономическая обсерватория ГАИШ . ... Любителям астрономии . История ГАИШ и Московской обсерватории . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... Welcome to the Extra-galactic research group of SAI ! ... Sternberg Astronomical Institute is older than the entire field of extra-galactic astronomy. ... At the same time, the Extra-galactic astronomy group as an element of the institute structure remains the youngest subdivision of SAI. ... 2007, astro-ph/0709.3047 . ...

Еще в разделе: (Показать все результаты (>36) - www.sai.msu.ru/ )

• Отдел внегалактической астрономии: ГАИШ Extra-galactic astronomy Group Press
• Отдел внегалактической астрономии: ГАИШ Extra-galactic astronomy Group Staff

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015

Еще в разделе: (Показать все результаты (>5) - cell.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...

Еще в разделе: (Показать все результаты (>7) - uneex.cs.msu.su/ )

... High Power Linear Accelerators . Fig 3a: One-section schematic . ... Our CW LINAC family consists of ten accelerators each with beam currents of 50 mA and energies ranging from 0.6 to 6 MeV in increments of 600 keV with corresponding beam power of 30 to 300 kW. ... Fig 4a: Two-section schematic . ... Our two-section CW LINAC seen in Fig. 4 consists of one-section CW LINAC, beam line between first and second AS, and second AS which accelerates the 50 mA beam up to the energy 1.2 MeV. ... 0.6 MeV . ...

Еще в разделе: (Показать все результаты (>4) - vserv.sinp.msu.ru/ )

• RTM-CS

... Форумы > Аспирантура > Тема . Автор темы ter . Форумы Список тем Новая тема . ... PhD positions in logic and AI, Vancouver (Canada) . PhD positions are available in the area of logic-based artificial intelligence. ... interested in logic (or discrete mathematics) and its uses for practical problem solving. ... Online application information is available at: . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>119) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное | Требуется Web - дизайнер.

. Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Water and Environment Journal . Weed Biology and Management . Weed Research . Winterthur Portfolio . WorkingUSA . World Banking Abstracts . World Englishes . World Oil Trade . Worldviews on Evidence-Based Nursing . Wound Repair and Regeneration . (495) 939-16-96, 939-42-04 . Copyright ї 2004 mailto:lib@phys.msu.su . Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . Разработано EA Studio .

Еще в разделе: (Показать все результаты (>6) - wwwlib.phys.msu.ru/ )

... Paradigm shifts by Kuhn: successive change of one model by another, rather than integration of different paradigms Progress of science: from single- to multi-model approach Some examples from natural science... · theory of light: from vibration of ether to wave-particle duality · laws of motion: from Newton's dynamics to SchrЖdinger 's and Heisenberg's formalism In social and environmental sciences appreciation of the multi-model ...

Еще в разделе: (Показать все результаты (>8) - oc.cs.msu.ru/ )

• http://oc.cs.msu.ru/eroven/page.htm

... The traditional answer to this question is unequivocal: тАЬno, public scholarship cannot and should not exist.тАЭ To popularize knowledge is to simplify, and simplification risks the loss of nuance and complexity, the very essence of scholarly knowledge. ... The public sphere can know but a distorted version of scholarly knowledge. ... You need JavaScript enabled to view it. (with Summer School-2016 in the subject line) before April 25, 2016. ... Summer School Archives . ...

Еще в разделе: (Показать все результаты (>12) - discours.philol.msu.ru/ )

• Publications

... Academic Programmes . ... Vestnik CIE (in Russian) . ... Elective Courses . ... The XIX century Russian Literature; . ... Open to all interested students, this course is especially useful for those who are preparing for Certificate examination (upper levels), or engaged in translation and interpreting; for teachers of Russian as a foreign language. The course s ultimate goal is to build a diversified set of skills that will enable students to explore various genres of Russian Media independently. ...

Еще в разделе: (Показать все результаты (>33) - www.cie.ru/ )

• Certification :: Les programmes d?enseignement :: CEI

... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...

Еще в разделе: (Показать все результаты (>13) - www.protein.bio.msu.ru/ )

• http://www.protein.bio.msu.ru/~akula/JourVND1104007KulaichevLO.pdf

... MPI_Win_fenc win); A[rank] = 4; MPI_Win_fenc win); MPI_Put ( .. ... MPI-2 I/O: MPI - -, , - , MPI « » - , , . ... int MPI _File_close( MPI_File *fh) INOUT fh () , fh , fh, , MPI _FILE_CLOSE int MPI _File_set_view( MPI_File fh, MPI _ Offset disp, MPI_Datatype etype, MPI_Datatype filetype, char *datarep, MPI _Info info) I I I I I I N N N N N N OUT fh () disp () etype () filetype () datarep () info () int MPI _File_get_view( MPI_File fh, MPI _ Offset *disp, MPI_Datatype *etype, ...

Еще в разделе: (Показать все результаты (>7) - angel.cmc.msu.ru/ )

• http://angel.cmc.msu.ru/~basrav/files/publications.pdf

COACHES . ... Kiseljev Dmitri . Head Coach . ... Lukyanchikov Dmitri . First Base coach, Power Lifting coach . ... Komissarov Dmitri . 3rd Base coach, Power Lifting coach . ... Erjemkin Alexey . ... Chichaev Ivan . ... Rich Reddrop* . ... Frolikov Alexey . ... Kudrjashov Alexander . ... Chichaev jr . ... Ned Reddrop* . ...

Еще в разделе: (Показать все результаты (>3) - mguteam.chat.ru/ )

• http://mguteam.chat.ru/komiss1.html

... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...

Еще в разделе: (Показать все результаты (>5) - ccoe.msu.ru/ )

ARM . 12: · ARM 2 ARM Powered Products 3 ARM · 4 · ARM 32- . ARM : ­ Byte - 8 bits ­ Halfword - 16 bits ( ) ­ Word - 32 bits ( ) · ARM ­ 32-bit ARM Instruction Set ­ 16-bit Thumb Instruction Set 5 · ARM : ­ User : , ­ FIQ : , high priority (fast) ­ IRQ : , low priority (normal) ­ Supervisor : Software Interrupt instruction ­ Abort : ­ Undef : ­ System : , 6 User ARM Current Visible Registers Abo Und rtMod SVCMode IRQ ef Mode FIQ Mode e User ...

Еще в разделе: (Показать все результаты (>7) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf

ISTITUTO NAZIONALE DI FISICA NUCLEARE Sezione di Genova INFN/TC-06/14 October 17, 2006 A FIBER OPTIC AIR BACKED MANDREL HYDROPHONE TO DETECT HIGH ENERGY HADRONIC SHOWERS IN THE WATER M.Anghinolfi1, A.Calvi3, A.Cotrufo3, M.Ivaldi1, O.Yershova2, F.Parodi1, D.Piombo1, A.Plotnikov2 and L.Repetto3 1) INFN-Sezione di ... UniversitЮ degli Studi di Genova, Dipartimento di Fisica Via Dodecaneso 33, I-16146 Genova, Italy Abstract We have studied the design of an air-backed ...

Еще в разделе: (Показать все результаты (>21) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/Shirokov%20-%20The%20first%20results%20of%20MSU%20groups%20in%20ANTARES%20project.pdf
• http://antares.sinp.msu.ru/docs/INFN%20-%20ANTARES.pdf

ft ra D DAYS on DIFFRACTION 2012 1 Theory of selfrefraction effect of intensive fo cused acoustical b eams V.A. Gusev Lomonosov's Moscow State University, Physical Faculty, Department of Acoustics, Russia, 119991, Moscow, Leninskie gori; e-mail: vgusev@bk.ru The theory of selfrefraction of nonlinear acoustical beams is developed based on some exact and approximate analytical equations and solutions. ... What is the main factor limiting the pressure in the focus -- diffraction or selfrefraction? ...

Еще в разделе: (Показать все результаты (>40) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/dd01.pdf

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>2) - sinp.msu.ru/ )

... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>13) - hcs.cmc.msu.ru/ )

• Master program "Enterprise Information Systems" | Магистерское и послевузовское
• Master program "Information Security and Cryptography" | Магистерское и