Президент РФ Д.А Медведев вручает Государственную премию . заведующему кафедрой Панченко Владиславу Яковлевичу . ... Заведующий кафедрой Панченко Владислав Яковлевич и другие лауреаты Государственной премии за 2009 год . ... ПАНЧЕНКО . ... Родился 15 сентября 1947 г. Окончил физический факультет Московского Государственного университета им. М.В. Ломоносова в 1971 г. Специальность по образованию - физик. 1975 г. - защитил кандидатскую диссертацию. 1990 г. - защитил докторскую диссертацию ...
... О КРУЖКАХ . ... МАЛЫЙ МЕХМАТ - ШКОЛЕ . ... Архив . ... Первое свое занятие математического кружка я провел в 1982 году, будучи студентом первого курса мехмата МГУ. ... Тут важно слово 'моего': свобода выбора тем и методики занятий на Малом мехмате довольно велика, другие кружки занимались совсем по-другому. Одно из главных отличий - б льшая часть времени на моем кружке уходит не на попытки школьников решать задачи, а на обсуждение решений и рассказ о связанных с темой занятия теоремах и понятиях. ...
... Клуб выпускников / Наши партнеры . ... Как разместить Ваш логотип на этой страничке . Е сли Вы хотите, чтобы мы разместили Ваш логотип на этой страничке, напишите нам письмо . И не забудьте на Вашей страничке поставить ссылку на Клуб Выпускников! ... Е сли Вы гордитесь тем, что имеете отношение к Московскому университету и хотите, чтобы об этом узнали окружающие, поместите на своей странице в Internet одну из следующих картинок! ...
Ionization Dynamics of Atoms Exposed to Strong Laser Pulses: SemiAnalytical Model at Low Field Frequencies Yu.V. Popov Skobeltsyn Institute of Nuclear Physics, Lomonosov Moscow State University Collaboration B. Piraux, A. Hamido. ... INTRODUCTION AND MOTIVATIONS Keldysh has introduced the adiabaticity parameter = (2Ip)1/2/E where is the laser field frequency, E, the field amplitude, and Ip the ionization potential of the atom. ... Both of them, multiphoton processes and tunnel ionization play a role. ...
Заполните, пожалуйста, все поля, чтобы информация о Вас появилась на обеих (русской и английской) страничках клуба. В течение нескольких дней Вы получите подтверждение о регистрации. Были жалобы, что автоматическая отсылка формы не работет, если браузер использует в качестве почтовой программы "The Bat!" В том случае, если Вы не получили ответа в течение 2-3 рабочих дней, . ... First name . ... Middle name . ... Last name . ... e-mail . ... Position, affilation and address: . ...
... Alexander A. Moskovsky . ... Software Designer : . ... Projects: . Janitor II, Custodian III for Matrix Logic - utilities for DOCS Open EDMS (electronic document management system), C++/Win32 platform. ~2 man-year project with 5 persons team. iBuzz - (for ibuzz.com ) large client-server system (Win32, Enterprize Java Beans, Oracle, Sun/Solaris). ... Lunch Ordering Web System. ... Software Resources International , former Digital Moscow Software Center, . ... Physical Chemistry chair, . ...
... Проект В помощь детскому саду , Дубна, форум 2006 . ... Группа ученых создала ?Лабораторию оптимизации природопользования?, где был разработан ряд новых подходов к экологическому образованию и воспитанию детей и подростков. ... С 22 по 26 мая 2000 г. под Воронежем мы провели школу-лагерь ?Ученые детям? как сателлитную программу очередной Международной конференции ?Математика. ... К.Б. Асланиди, М.А. Малярова, Т.В. Потапова, Н.Г. Рыбальский, О.Ю.Цитцер "Экологическая азбука для детей и подростков". ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Sparse matrix package . ... Памяти безразмерный параметр . Nondimensional memory parameter . ... Parallel flow . ... The line parallel to the tangent $k(S^{(1)})$ at the point $x$ . ... The particles impart (transfer) their energies to the fragments resulting from (the) collision . ... Front (anterior) surface of a (the) body . ... Transport field . ... Under the above transformations, the set $X$ goes into a set $Y$ . ... Electric field across the body surface . ... Flow-and-temperature field . ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
. Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 29 . Strict Standards : Non-static method JLoader::register() should not be called statically in /wcmc/ms/ms/libraries/loader.php on line 71 . Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 32 . Strict Standards : Non-static method JLoader::register() should not be called
Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS WxtЊ vҐЂЂxtzтxс4 g{x YtvтЂрч Ґy TЊрс уxЊx tvvx¶рxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...
ANTARES Collaboration Meeting . ... Group photo in front of Lomonosov monument and MSU Main Building . ... We are pleased to welcome you to Moscow State University, where June 6-10, 2011 the ANTARES Collaboration Meeting will be held. Moscow State University is one of the tourist attractions of Moscow, an architectural monument and the tallest university building of the world. ... Antonio Capone, Physics Department University "Sapienza" and INFN, Roma . ... Salvatore Mangano, IFIC-CSIC, Valencia . ...
... Earlier still lies the remaining frontier, where the first stars, galaxies and massive black holes formed. ... Building on this general framework, and relying on the development of efficient new computational tools, the fragmentation properties of primordial gas inside such minihaloes were investigated with numerical simulations, leading to the result that the first stars, so-called population III, were predominantly very massive4,8 (see Box 1 for the terminology used here). ... Astrophys. ... III. ...
[
Текст
]
Ссылки http://ocean.phys.msu.ru/courses/geo/lectures-addons/02/2009%20Bromm%20et%20al.%2C%20The%20formation%20of%20the%20first%20stars%20and%20galaxies.pdf -- 799.2 Кб -- 28.08.2009 Похожие документы
... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
... Публикации . ... О ВШГА МГУ . ... Бюрократия с акцентом . ... Доступ к элите французской бюрократии Еремину дает диплом знаменитой французской L'Ecole Nationale D'Administration - Национальной школы администрации (ENA). У нас нет специальных галстуков, как в Гарварде, но достаточно два года проучиться в ENA, чтобы почувствовать наше братство', - говорит Еремин. ... При МГУ создано уже пять школ такого типа, и все их финансирует Дерипаска', - поясняет директор ВШГА, академик РАН Валерий Макаров. ...
Информационное письмо БФ-01 (23.01.96) О начале финанстрования РФФИ и начале реализации проекта БАФИЗ-96 (РФФИ номер 95-07-19502). ... В связи с этим, 16 января 1996 года мы провели совещание с частью основных исполнителей из институтов-участников проекта БАФИЗ-96. Приглашения по e-mail были направлены во все семь институтов- участников проекта: ОИЯИ, НИИЯФ МГУ, ИФВЭ, ИТЭФ, ИЯИ, ПИЯФ, ИЯФ СОРАН. ... 8) Хранение и обеспечение эффективного поиска в полнотекстовых и гипертекстовых базах данных. ...