Application of evolutionary model in the evaluation of the quality of pair wise alignment of amino acid sequences Valery Polyanovsky, V. G. Tumanyan Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, 119991 Russia ... : polyanovskyvo@mailfrom.ru, tuman@eimb.ru The purpose of the work is to develop a universal method for estimating the pairwise alignment quality depending on the evolutionary distance (degree of homology) between the ... REFERENCES 1. ...

Еще в разделе: (Показать все результаты (>239) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/161.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/164.pdf

A.N. Belozersky Institute . Bioinformatics Portal . ... Russian EMBnet Node . ... AliBee - Multiple alignment Release 2.0 . ... Grants information . ... Our Institute is a scientific department of Moscow State University. ... Address: Belozersky Institute,Moscow State University,Leninskie Gory 1,Bldg. ... Information about our activities and EMBnet resources around the World is available here . Information about our educational activities with kids, children and teenagers is available here . ...

Еще в разделе: (Показать все результаты (>189) - www.genebee.msu.ru/ )

• AliComp - GeneBee Alignment Comparison Help
• AliComp - GeneBee Alignments Comparison - Advanced
• IGLA-3D User Guide

Some additional inquiry information . ... help information) . Here you can read some articles, describing details of calculting process. We hope, after having these articles read, you'll surely know, what and how does this program work. Alignment formats . ... WPGMA - method for sequence weighting and tree constructing . Alignment quality estimation: "The rule of fours" . Phylogenetic tree schemes . Criteria of branch quality . Evolution reconstruction: parsimony method . ...

Еще в разделе: (Показать все результаты (>482) - monkey.belozersky.msu.ru/ )

• Inquiry information || Formats of alignments
• About authors ot this complex
• SDP home page

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>26) - mouse.genebee.msu.ru/ )

• ConClus
• Align tool for DNA-protein complexes
• Comparison of protein phylogeny reconstruction methods

... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>6979) - mouse.belozersky.msu.ru/ )

... MSU Codec Comparison aims to deliver high quality comparisons of video encoders to both industrial and scientific communities. ... The newest versions of MPEG-4 codecs comparison for their using by an ordinary user for home video compression. ... First Annual MPEG-4 AVC/ H.264 Video Codecs Comparison (January 2005) . ... Second Annual MPEG-4 AVC/H.264 Video Codecs Comparison(December 2005) . ... Third Annual MPEG-4 AVC/H.264 Video Codecs Comparison (December 2006) . ... Fifth H.264 codecs comparison...

Еще в разделе: (Показать все результаты (>300) - graphics.cs.msu.ru/ )

• MSU Video Codec Comparison | Лаборатория компьютерной графики и мультимедиа
• Age Estimation Using Additional Unlabeled Face Images | Graphics and Media Lab
• GML AdaBoost Matlab Toolbox | Лаборатория компьютерной графики и мультимедиа

A comparison of algorithms for spiral tomography" . Pickalov V.V. and Likhachev A.V. The paper deals with the three-dimensional transmission tomography problem. ... The main attention is paid to the comparison of the algorithms based on the equations of quasi-exact inversion with the approximate iterative method ART. ... PostScript (in Russian) (8.33MB) . PDF (in Russian) (765KB) . ... Pickalov V.V. and Likhachev A.V. e-mail: pickalov@itam.nsc.ru ; http://www.itam.nsc.ru/lab17 ...

Еще в разделе: (Показать все результаты (>432) - num-meth.srcc.msu.ru/ )

• "Comparison of the Verlet table and cell-linked list algorithms for sequential,
• "Screen video compression with a video card. Comparison of technologies"
• "A comparison of explicit and implicit numerical methods for solving

Электронная библиотека Попечительского совета . ... Althaus E. - A branch-and-cut algorithm for multiple sequence alignment . ... Название: A branch-and-cut algorithm for multiple sequence alignment . Автор: Althaus E. Язык: . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>9154) - lib.mexmat.ru/ )

• Ng E.W. - A Comparison of Computational Methods and Algorithms for the Complex
• Lander E.S., Waterman M.S. (eds.) - Calculating the Secrets of Life:
• Al-Hakim L., Memmola M. - Business web strategy: design, alignment and

FASTA /TFASTA/FASTX/TFASTXv3(1) FASTA /TFASTA/FASTX/TFASTXv3(1) NAME fasta3, fasta3_t - scan a protein or DNA sequence library for similar sequences tfasta3, tfasta3_t - compare a protein sequence to a DNA sequence library , translating the DNA sequence library `on-the-fly'. fastx3, fastx3_t - compare a DNA sequence to a protein sequence ... REF_URL the format string used to define the option to lookup the library sequence in entrez, or some other database. ...

Еще в разделе: (Показать все результаты (>2141) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.su/FBB/year_04/doc/BLAST_help/bl2seq.html
• http://kodomo.cmm.msu.ru/~ellys/blosum.html
• SDPpred

A problem, that can arise when moving from Fortran 77 to Fortran 90, is dependent on a usual deviation from the standard, and has to do especially with user programs. ... With many Fortran 77 implementations we wrote PROGRAM TEST REAL X WRITE(*,10) 10 FORMAT('Give X = ',$) READ(*,*) X WRITE(*,*) X END In Fortran 90 we use "non-advancing I/O" instead. ... In some old Fortran dialects the statement TYPE was used to write on a typewriter terminal and PRINT was used to write on the line printer. ...

Еще в разделе: (Показать все результаты (>3702) - crydee.sai.msu.ru/ )

• Appendix D: The grammar of CSS2

Given word length and max number of mismatches . Use MEME algorithm for define conserved blocks . Apply the Dynamic programming algorithm to create chain of the blocks . Refine the chain using combined profile for chain of blocks. ... Reduce word length and number of mismatches and repeat the procedure for spacer between the blocks. ... Create helix profile and apply MEME-like iterative procedure to find sets of helices that consistent lokated reative to conserved blocks . ...

Еще в разделе: (Показать все результаты (>142) - bioinf.fbb.msu.ru/ )

• SDPpred
• <