... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Algorithms for calculating parameters of virtual scenes in computer vision tasks . ...

Еще в разделе: (Показать все результаты (>901) - graphics.cs.msu.ru/ )

Evolution as a hard combinatorial problem D. Grigoriev, CNRS, Universitґ de Lille, dmitry.grigoryev@math.univ-lille1.fr e J.Reinitz, Dept.of Statistics, Chicago University, reinitz@galton.uchicago.edu S. Vakulenko, Institute for Mechanical Engineering Problems, Saint Petersburg, vakulenfr@mail.ru A. Weber, Computer Science Department, University of Bonn, weber@cs.uni-bonn.de We consider complexity emergence problem and formation of complex organs. ... The number n >> 1 is the gene number. ...

Еще в разделе: (Показать все результаты (>331) - mccmb.belozersky.msu.ru/ )

... Publications . ... Number of publications 0 . ... Publication type . ... Borisov A. V. , Kazakov A. O. , Sataev I. R. The Reversal and Chaotic Attractor in the Nonholonomic Model of Chaplygin?s Top . Regular and Chaotic Dynamics, 2014, vol. 19, no. 6, pp. ... Borisov A. V., Kazakov A. O., Sataev I. R., Regular and Chaotic Attractors in the Nonholonomic Model of Chapygin's ball, Russian Journal of Nonlinear Dynamics, 2014, vol. 10, no. 3, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>223) - ics.org.ru/ )

• Institute of Computer Sciences - Journals
• Institute of Computer Sciences - Contacts

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>4288) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Nucleus Ground State Parameters
• CDFE => Online services => Chart of nucleus shape and size parameters
• CDFE => Online Services

... Fridinger P.G., Reverdatto V.V., Polyansky O.P. Burial sediments metamorphism in rift structures of Earth crust (modeling approach), Geology and Geophysics, 1991, N9, p. 81-90 (in Russian) . ... Reverdatto V.V., Polyansky O.P. PT-evolution in alternative models of metamorphism , Reports of AS USSR, 1992, v.325, N5, p.1017-1020 (in Russian) . ... Reverdatto V.V., Sheplev V.S., Polyansky O.P. , Burial metamorphism and evolution of rift depressions, Petrology, 1995, v.3, N1, p.37-44 (in Russian) . ...

Еще в разделе: (Показать все результаты (>768) - geo.web.ru/ )

• Ссылки на сейсмотомографические сайты

... Kaisa M. - Evolutionary Algorithms in Engineering and Computer Science: Recent Advances in Genetic Algorithms, Evolution Strategies, Evolutionary Programming, Genetic Programming and Industrial Applications . ... Название: Evolutionary Algorithms in Engineering and Computer Science: Recent Advances in Genetic Algorithms, Evolution Strategies, Evolutionary Programming, Genetic Programming and Industrial Applications . ... Finland J. P?riaux, Dassault Aviation, France What is Evolutionary Computing? ...

Еще в разделе: (Показать все результаты (>22128) - lib.mexmat.ru/ )

• Engel K.-J., Nagel R. - One-parameter Semigrs for Linear Evolution Equations ::
• Michalewicz Z. - Genetic algorithms + data structures = evolution programs ::
• Heermann D.W. - Computer Simulation Methods in Theoretical Physics ::

... Science . ... 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . ... Main Science and education Scientific Laboratories Laboratory of computer simulations in optics . ... Dergachev Aleksandr Aleksandrovich engineer, Ph.D. Dormidonov Aleksandr Evgen'evich Ph.D. Kandidov Valeriy Petrovich professor, Doctor of science . ... Femtosecond Nonlinear Optics of High Power Laser Radiation . Femtosecond TW Laser Pulse Filamentation in Gases and Condensed Media . ...

Еще в разделе: (Показать все результаты (>203) - ofvp.phys.msu.ru/ )

... A reconfigurable computer system based on FPGAs with liquid cooling" . Levin I.I., Dordopulo A.I., Doronchenko Yu.I., Raskladkin M.K., and Fedorov A.M. The paper deals with problems of design of promising reconfigurable computer systems with liquid cooling for Xilinx Virtex UltraScale FPGAs. ... Keywords: reconfigurable computer systems, FPGAs, liquid cooling, computational module, high-performance computer systems, real and specific performance, power efficiency. ...

Еще в разделе: (Показать все результаты (>689) - num-meth.srcc.msu.ru/ )

• "An algorithm of assigning the force parameters to atoms of organic molecules
• Contents.Volume 7
• "Heuristic algorithms of mapping MPI-programs onto multicluster computer and

... The Study of Acoustic Nonlinearity Parameter Tomography in Reflection Mode . ... Based on the theory of propagation of reflected second harmonics in the layered medium and the insert-substitution method of finite amplitude sound wave, the computer simulation of nonlinearity parameter tomography from calculated reflected second harmonic data and filtered convolution algorithm used in the conventional CT technique is reported and the images of B/A for several biological specimens are reconstructed. ...

Еще в разделе: (Показать все результаты (>719) - acs366.phys.msu.su/ )

• Modern Group Analysis (MOGRAN 9)
• Nonlinear Acoustics of Fluids and Multi-Phase Media, Cavitation Phenomena

MSSM Finite-Temperature Higgs Potential for Phase Transition Mikhail Dolgopolov (Samara State University) Dubinin M. (SINP MSU) Rykova E. (SSU) · · · · Introduction Finite-temperature corrections of squarks Thermal evolution and the critical temperature Conclusions Outline [ M. Dolgopolov, M. Dubinin, E. Rykova Threshold corrections to the MSSM finitetemperature Higgs potential. ... 1973 GeV Ilya F. Ginzburg, M. Krawczyk, Symmetries of two Higgs doublet model and CP violation. ...

Еще в разделе: (Показать все результаты (>229) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/qfthep2010_dubinin.pdf

... Государственный Астрономический Институт имени П.К. Штернберга МГУ . ... Семинары ГАИШ . ... Государственный астрономический институт им. П.К.Штернберга (ГАИШ) научно-исследовательский институт, являющийся одним из подразделений МГУ им. М.В. Ломоносова . ... 11 декабря 2006 года исполнилось 175 лет со дня создания на Пресне Астрономической обсерватории Московского университета, ставшей впоследствии базой для формирования Государственного астрономического института им. П.К. Штернберга (ГАИШ МГУ). ...

Еще в разделе: (Показать все результаты (>121) - sai.msu.ru/ )

... 18 27 апреля 2016 года . ... СЕМИНАР ПО МЕХАНИКЕ СПЛОШНЫХ СРЕД . В среду, 13 апреля 2016 г., в кинозале Института механики МГУ в 12.00 состоится очередное заседание семинара по механике сплошных сред под руководством А.Г. Куликовского, В.П. Карликова и О.Э. Мельника. ... версия для печати 2016-04-07 . ... 260 заседание семинара ?Физико-химическая кинетика в газовой динамике? состоится в четверг 07 апреля 2016 года (11 часов, кинозал Института механики МГУ) . ... НИИ механики МГУ, 2002 2016. ...

Еще в разделе: (Показать все результаты (>4) - www.imec.msu.ru/ )

... Previous message: [Computer_algebra] CA Seminar on December 24 . ... Moscow State University after M.V.Lomonosov "Parallel Algorithms for Groebner and Involutive Bases Computation" ABSTRACT Polynomial systems solving is one of the most important tasks of the modern computer algebra. ... Мехмат МГУ "Параллельные алгоритмы вычисления базисов Гребнера и инволютивных базисов" АБСТРАКТ Одной из важных задач компьютерной алгебры является решение систем нелинейных алгебраических уравнений. ...

Еще в разделе: (Показать все результаты (>15411) - theory.sinp.msu.ru/ )

• [Computer_algebra] Fw: CA Seminar on December 24
• calg:archive07 [THEP]
• [Computer_algebra] CA Seminar on Wednesday, April 16

... Moscow S. V. Ajukov THE SOLAR ENVELOPE PARAMETERS AND RADIATIVE OPACITIES IN THE MODELS OF THE PRESENT SUN Comparison of the different opacity tables at the solar core conditions. ... The convection zone depth versus the envelope entropy for the three opacity tables. ... The influence of opacity on the standard solar model parameters Increasing opacities from CS70 up to LAOL (WKM) (both in the core and the radiative zone) raises helium content by 4--5%. ... Solar models with modified opacities . ...

Еще в разделе: (Показать все результаты (>1806) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/local/science/publications/wien.92/wien92.ps.gz
• Tutorial on Fortran 90, Digital UNIX
• Publications

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

A very important stage in a story of formation of any new science is the shift from discussion of situation which are possible but do not occur in practice due to some reason to recognition of real phenomena of interest. ... We suggest to consider computer viruses as this new specific form of life which is coming in the contact with our form of life. ... Computer life has been created by human being, the role of independent evolution of computer viruses seems to be still negligible. ...

Еще в разделе: (Показать все результаты (>344) - lnfm1.sai.msu.ru/ )

• Scientific activity
• Data bases of Natural Satellites. Documentation. Structure

... DEVELOPMENT OF EXPLICIT CYCLIC SCHEMES . WITH CHEBYSHEV?S POLYNOMIALS FOR SPACE NEUTRON KINETICS . ... Questions have been studied to use effectively explicit schemes for solving spatial kinetics. ... Algorithms have been developed to solve spatial kinetic equations on the basis of explicit cyclic schemes with time varying steps designed by V.I. Lebedev [1] as well as schemes of local iterations proposed by O.V. Lokutsievskiy and V.O. Lokutsievskiy [2]. ... Code development. ...

Еще в разделе: (Показать все результаты (>169) - sp.cs.msu.ru/ )

• DVM-system. Goals and structure

ITPM MSU . Quantum Computing Page . ... Quantum Computation/Cryptography at LosAlamos . Quantum Information at Los Alamos National Laboratory . Laboratory for Theoretical and Quantum Computing ( Universite de Montreal ) . Quantum information and quantum computation at IBM . ... Centre for Quantum Computation . Quantum Information Page . Quantum Information and Computation . ... Quantum Information and Quantum Computing (by Reinhard F. Werner) . ... c) ITPM MSU 1998, 1999 ...

19. Flowers: Diversity, Development and Evolution

20. Procedia computer science - журнал | ИСТИНА - Интеллектуальная Система