... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>13) - www.issp.ac.ru/ )

Table 1. One-factor characteristics of dependence of plankton and periphyton ecological state on polluting compounds . Factors . ... 231 . ... 116 . ... 115 . ... 0.000 . ... 231.000 . 0.150 . ... 100 . ... N = number of observations; N1 = number of normal observations; N2 = number of abnormal observations; Min is the minimum factor value for the period of observation; Max is the maximum factor value for the period of observation; ETL is the ecologially tolerable level of the factor. ...

Еще в разделе: (Показать все результаты (>501) - chronos.msu.ru/ )

• A METHOD FOR DETERMINING ECOSYSTEM NORMAL FUNCTIONING REGIONS

... Kraus D. - A boundary version of Ahlfors` lemma, locally complete conformal metrics and conformally invariant reflection principles for analytic maps . ... Название: A boundary version of Ahlfors` lemma, locally complete conformal metrics and conformally invariant reflection principles for analytic maps . Автор: Kraus D. Язык: . ...

Еще в разделе: (Показать все результаты (>15350) - lib.mexmat.ru/ )

• Lotov V.I. - Complete asymptotic expansion in two-boundary problems for random
• Bousfield A., Kan D. - Homotopy limits, completions and localizations ::
• McConnell S. - Code Complete :: Электронная библиотека попечительского совета

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>224) - graphics.cs.msu.ru/ )

• Automatic building texture completion | Graphics and Media Lab
• Automatic building texture completion | Лаборатория компьютерной графики и
• Graphics and Media Lab | CMC department, Lomonosov Moscow State University

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>105) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the Bourne Again SHell

NP-Completeness . Software with efficient algorithm designing for hard computational problems. It includes a new NP-complete problem named SAT01, which is suitable for reduction to it and for solving algorithms development. ... Home Site: . ... None . ... User Comments: . ... SAL Home | Numerical Analysis | Optimization . Comments? SAL@KachinaTech.COM . Copyright 1995-2001 by Herng-Jeng Jou . Copyright 1997-2001 by Kachina Technologies, Inc. ...

Еще в разделе: (Показать все результаты (>2912) - www.sai.msu.su/ )

• APOD: April 2, 1997 - A Complete Aurora
• APOD: 2007 December 3 - A Complete Solar Cycle from SOHO
• FTS Complete Tutorial

... Ephemerides . ... Natural Satellites Data Center service. ... Please complete the form below, fields marked with * should be filled. See List of keywords for object List of keywords for subject Main journals list . ... by Keywords Title Title, Keywords and Abstract Authors Journal/Livre/Rapport: . ... AND OR NOT Exact sentence (within this field) AND . ... AND OR NOT Exact sentence (within this field) . ... Keywords . ... AND OR NOT Exact sentence . within this field) . ...

Еще в разделе: (Показать все результаты (>488) - lnfm1.sai.msu.ru/ )

• Russian SETI
• Труды Варфоломеева М.И.
• Data bases of Natural Satellites. Documentation. Structure

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2102) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~contradiction/term3/bln_y.txt
• http://kodomo.cmm.msu.ru/~mmetelev/Term3/bln.txt
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt

... Feature of exciplexes with complete and partial electron transfer formed are analyzed. ... For exciplexes with complete charge transfer (the degree of charge transfer z>0.8 and the energy gap between CT- and LE-states in vacuum (driving force of electron transfer) (H220 - H110) < -0.3 eV), the main contribution to the exciplex energy gives the energy of electron transfer. ... Exciplex energy is substantially lower than that of LE-state even when (H220 - H110) > 0. ...

Еще в разделе: (Показать все результаты (>660) - chem.msu.ru/ )

... A Complete Solar Cycle from SOHO . ... 3.12.2007 . ... Credit: SOHO - EIT Consortium , ESA , NASA Explanation: Every eleven years, our Sun goes through a solar cycle. ... Solar minimums occurred in 1996 and 2007, while the last solar maximum occurred in 2001 Pictured above is a SOHO image of the Sun in extreme ultraviolet light for each year of the last solar cycle , with images picked to illustrate the relative activity of the Sun. ... Publications with keywords: solar cycle - solar maximum - SOHO ...

Еще в разделе: (Показать все результаты (>9656) - www.astronet.ru/ )

• A Complete Aurora
• Астронет > A Complete Solar Cycle from SOHO
• Астронет > A Complete Aurora

. [ Войти ] . Главная -> Фильмы -> Lego Star Wars: The Complete.. Пользователи . Демо . Деньги . Фильмы . Форум . Lego Star Wars: The Complete Saga . Великобритания 2007 . отметить . Комедия . Фантастика . Игра . Фэнтэзи . Боевик .

Еще в разделе: (Показать все результаты (>56) - kinfo.ru/ )

• Complete Savages - Фильмы - Kinfo.ru
• The Completely Mental Misadv.. - Фильмы - Kinfo.ru
• Complete Guide to Guys - Фильмы - Kinfo.ru

PHP Manual . ... Parsing and execution are now two completely separated steps, no execution of a files code will happen until the complete file and everything it requires has completely and successfully been parsed. One of the new requirements introduced with this split is that required and included files now have to be syntactically complete. You can no longer spread the different controlling parts of a control structure across file boundaries. ... Migrating Configuration Files . ...

Еще в разделе: (Показать все результаты (>225) - oit.cmc.msu.ru/ )

• readline_completion_function
• register_shutdown_function
• yaz_wait

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: i just completed a whole powerpoint prese . ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . Вы не можете публиковать новые темы в этом форуме . ...

Еще в разделе: (Показать все результаты (>5253) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: Over nearly the complete
• Экологический Форум - Фундаментальная Экология: Over virtually the complete
• Laboratories: Laboratory for Ecology of Arid Territories: Publications

... Communication Completion . ... MPI_REQUEST_NULL. ... A empty status is a status which is set to return tag = MPI_ANY_TAG, source = MPI_ANY_SOURCE, and is also internally configured so that calls to MPI_GET_COUNT and MPI_GET_ELEMENTS return count = 0. ... INTEGER REQUEST, STATUS(MPI_STATUS_SIZE), IERROR . ... Once a request is freed by a call to MPI_REQUEST_FREE, it is not possible to check for the successful completion of the associated communication with calls to MPI_WAIT or MPI_TEST. ... Центры . ...

Еще в разделе: (Показать все результаты (>443) - www.parallel.ru/ )

• Progress | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Client/Server Examples | PARALLEL.RU - Информационно-аналитический центр по
• Semantics of Nonblocking Communications | PARALLEL.RU -

... About Conference . ... Bookstall . All books . Books by MCE participants . ... Password: . ... Approximate price in Conference bookstall 200 roubles. You need to submit Conference application first to order books to Conference bookstall. If you have already registered just enter your username and password. ... 2004 Designed by Lyceum of Informational Technologies ?1533 . ...

Еще в разделе: (Показать все результаты (>242) - www.mce.biophys.msu.ru/ )

... 2016-Apr-09 18:10:24 . ... application/octet-stream . ... 3.0K . text/plain . ... text/xml . ...

Еще в разделе: (Показать все результаты (>15361) - mirror.msu.net/ )

• Index of /pub/slackware-current/extra/source/bash-completion/
• Index of /pub/gentoo-portage/app-emacs/scheme-complete/
• Index of /pub/slackware-current/extra/bash-completion/

... ON LANGUAGE . ... TOWARD THE LANGUAGE OF HAPPINESS . ...

Еще в разделе: (Показать все результаты (>144) - www.psy.msu.ru/ )

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>8) - bioinf.fbb.msu.ru/ )

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ...

Еще в разделе: (Показать все результаты (>3167) - istina.msu.ru/ )

• Mingaliev M.G. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

Calculation of optimal coefficients for quadrature formulas by the complete enumeration method" . O.V. Belen'kaya, Ya.M. Zhileikin, and A.B. Kukarkin . Optimal coefficients of number-theoretic quadrature formulas are calculated for the two-dimensional case by the complete enumeration method. Optimal coefficients obtained by several different methods are compared. PostScript (in Russian) (87.1KB) . PDF (in Russian) (114KB) . PostScript. zip (in Russian) (30.7KB) . ...

Еще в разделе: (Показать все результаты (>333) - num-meth.srcc.msu.ru/ )

• "Methods of text fragment relevance estimation based on the topic model
• "A more accurate threshold in bilateral control and observation problems for