... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out

... Chandra Observation of LMXB in M84 . We present characteristics of the X-ray point source population in the M84 field as observed by Chandra ACIS-S. We find the galactic sources in M84 follow the stellar light profile, which imposes similar formation histories for stars in both single and binary systems. After correcting for incompleteness in the source detection, we find a log N-log S similar to that of the elliptical galaxy NGC4697. ...

Еще в разделе: (Показать все результаты (>496) - xray.sai.msu.ru/ )

• Case B: #tex2html_wrap_inline768#

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... testing Test Complete . ... тул Test Complete для автотестирования, кто нить работал с ним? . ... Re: testing Test Complete [ re: nafania ] . ...

Еще в разделе: (Показать все результаты (>1937) - www.fds-net.ru/ )

• Новинки (аниме, осты, фильмы, дорамы...) - Public forum of MSU united student

mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Thu Feb 27 00:45:37 MSK 1997 mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Sun Mar 16 16:18:45 MSK 1997 Got INDEX.TXT 1613 Got allstar.exe 220223 Got wdatide.exe 72687 Got wd_diag.exe 60960 Got wd_clear.exe 54968 Got coretst.exe 33949 ...

Еще в разделе: (Показать все результаты (>5308) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/rec/music/lyrics/cs-uwp/n/new.order/movement.1
• http://crydee.sai.msu.ru/ftproot/pub/comp/hardware/cdr/jarnold/.mirror
• http://crydee.sai.msu.ru/ftproot/pub/rec/music/lyrics/cs-uwp/folk/s/shape_of_my_love

. Портал | Содержание | О нас | Авторам | Новости | Первая десятка | Дискуссионный клуб | Научный форум | Отправить открытку . Первая десятка "Русского переплета" Темы дня: . | Обращение к Дмитрию Олеговичу Рогозину по теме "космические угрозы": как сделать систему предупреждения? .

Еще в разделе: (Показать все результаты (>157) - www.pereplet.ru/ )

... In many areas of physics, in particular, in gravitation and quantum field theory, to solve the physical problem one has to find solutions of nonlinear ordinary differential equations or systems of such equations. ... At the same time there exist methods, which allow to find special solutions of systems of ordinary differential equations in the form of elementary or elliptic functions, reducing the initial system to a system of nonlinear algebraic equations. ...

Еще в разделе: (Показать все результаты (>553) - theory.sinp.msu.ru/ )

• [RU-NGI] Fwd: [LCG-ROLLOUT] [EGI BROADCAST] Decommission of gridops.org
• Sergey Yurievich Vernov (Institute of Nuclear Physics, Moscow State University)

My colleagues and I have recently completed a series of observations of SN1999an. ... The telescope is located at Martin Observatory in Blacksburg, VA, and is operated by the Physics Department of Virginia Tech. Our IAU Minor Planet Center Observatory Code is 841. ... Attached you will find a copy of one of our images (in .jpg format) with the supernova indicated. ... Virginia Tech Department of Physics . Back to Bright Supernovae . Back to Supernova 1999an . ...

Еще в разделе: (Показать все результаты (>437) - www.rochesterastronomy.org/ )

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>8044) - kodomo.fbb.msu.ru/ )

• allpy: 56bea23d3c73 lib/fasta.py
• allpy: 56bea23d3c73 __init__.py
• allpy: 56bea23d3c73

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>137) - www.fadr.msu.ru/ )

... РЕФЕРАТЫ СТАТЕЙ ПО РУКОКРЫЛЫМ / ABSTRACTS OF BAT ARTICLES . Глобальная оценка полноты ископаемых остатков рукокрылых / Global completeness of the bat fossil record: - Eiting, T.P., Gunnell, G.F., Journal of Mammalian Evolution, 16(3): 151-173, 2009. ... Measures of completeness of the fossil record have important consequences for our understanding of evolutionary rates and patterns among bats. ... At the genus level, the bat fossil record is estimated to be 12% complete. ...

Еще в разделе: (Показать все результаты (>1422) - zmmu.msu.ru/ )

• Russian Journal of Theriology
• Order Chiroptera

Literature . ... Computers and Statistical Data Analysis. ... In Russian. ... Basic notions and methods of applied statistical analysis and usage of leading Russian and American statistical software tools: STADIA, STATGRAPHICS. ... The second edition has much more detailed depiction of temporal series analysis methods, review of statistical packages for Windows and recommendations on their choosing. ... Kulaichev A.P. Data Analysis Methods And Tools for Windows . ... In English and In Russian. ...

Еще в разделе: (Показать все результаты (>6) - statsoft.msu.ru/ )

Microsymposium 34, MS015, 2001 TO THE DISCOVERY OF THE "SOUTH POLE - AITKEN " BASIN. ... Head [2] and Spudis [1] suggested in their reviews that the existense of the structure identified later as the South Pole - Aitken baasin was first predicted on the basis of a relief analysis of the mountain ridges observed in the libration zone be Hartman and Kuiper [7], i.e. after the first images of the lunar far-side had been obtained. ... SOUTH POLE-AIKEN BASIN: V.I.Chikmachev et al. ...

Еще в разделе: (Показать все результаты (>102) - selena.sai.msu.ru/ )

• Yurii Naumovich Lipsky
• Works of the Department of lunar and planetary research of GAISh MGU

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>123) - hist.msu.ru/ )

. This is the complete list of member functions and enum types for QNPStream , including all inherited members. QNPStream . complete . end . instance . lastModified . okay . requestRead . seekable . setComplete . setOkay . type . url . write . ~QNPStream . Copyright © 1998 Troll Tech . Trademarks . Qt version 1.40

Еще в разделе: (Показать все результаты (>524) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - application/application.cpp example file
• Qt Toolkit - QNPStream Class
• Qt Toolkit - QXtWidget member list

. Estimates of complete rational trigonometric sums with a prime denominator} / A. N. Vasil'ev. //Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. 2014. ? 2. P. 55-59 [Moscow Univ. Math. Bulletin. Vol. 69, N 2, 2014.]. Upper bounds are proved for special complete rational exponential sums with a prime denominator. Key words : upper bounds, complete rational exponential sums. ? 2/2014 . Toggle formulas format . (LaTeX / SVG)

Еще в разделе: (Показать все результаты (>216) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2011

Alders in the European Russia: thesis , poster (PDF) and article . Carnivorous plants: . ... Nymphaea : . ... Morphological variability of Nymphaea alba L. s.l. (Nymphaeaceae) in the European Russia . Morphological variation in Nymphaea (Nymphaeaceae) in European Russia: 2006 and 2008 [PDF] . Evolutionary dynamics across discontinuous freshwater systems: Rapid expansions and repeated allopolyploid origins in the Palearctic white water-lilies ( Nymphaea ) [PDF] . ...

Еще в разделе: (Показать все результаты (>283) - herba.msu.ru/ )

• Complete flora of islands and lakes as a statistical hypothesis
• Systema Naturae
• New Page 1

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>19) - angel.cs.msu.su/ )

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>20) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc

Next: Kernel Options in 1.1.14 Up: Kernel Configuration Previous: Kernel Configuration . After the general option part is complete, the configuration will go on to ask you for various features such as SCSI drivers, etc. The subsequent list questions deal with networking support. ... A typical list of options offered by most kernel versions around 1.0 and 1.1 looks like this (comments are given in italics): . ... SLIP allows you to transport IP datagrams across serial lines. ...

Еще в разделе: (Показать все результаты (>233) - itpm.msu.su/ )

• The Network File System
• Formatting
• The Linux Kernel (Copyright Notice)

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>136) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!