. LCore is a program for classification of 3D structures of macromolecular complexes on the basis of their geometric core. Distance threshold (?) . Minimal core size (#aa's) . Alternative core new atoms (%) . Max number of cores on output . Core identifier for chain superimposition (0 for the main core) .

Еще в разделе: (Показать все результаты (>16564) - mouse.belozersky.msu.ru/ )

• Geometrical core
• wLake program homepage

Электронная библиотека Попечительского совета . ... Mejlbro L. - Complex Functions c-1 - Examples concerning Complex Numbers . ... Название: Complex Functions c-1 - Examples concerning Complex Numbers . Автор: Mejlbro L. Язык: . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>22209) - lib.mexmat.ru/ )

• Mejlbro L. - Calculus Analyse lc-4, Complex Numbers Examples :: Электронная
• Поиск книг, содержащих Real number :: Электронная библиотека попечительского
• Yaglom I.M. - Complex Numbers in Geometry :: Электронная библиотека

Network Working Group P. Eronen Request for Comments: 5612 Nokia Category: Informational D. Harrington Huawei Technologies (USA) August 2009 Enterprise Number for Documentation Use Abstract This document describes an Enterprise Number (also known as SMI Network Management Private Enterprise Code) for use in documentation. ... This Enterprise Number is not intended to be implemented. ... Eronen & Harrington Informational [Page 2] RFC 5612 Enterprise Number for Documentation Use August 2009 6. ...

Еще в разделе: (Показать все результаты (>24179) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc5612.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc5398.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc5398.txt

... The LanHEP input file is the sequence of statements, each starts with a special identifier (such as parameter, lterm etc) and ends with the full-stop ' . ... This section is aimed to clarify the syntax of LanHEP input files, i.e. the structure of the statements. ... Let us consider the LanHEP input files for the Standard Model with both the t'Hooft-Feynman and unitary gauges. ... LanHEP allows the user to define several keys , and use these keys to branch among several variants of the model. ...

Еще в разделе: (Показать все результаты (>1833) - theory.sinp.msu.ru/ )

• Reduce program
• The genEvents command
• Menu 8.

... Run program . User's guide . Launching program . Input data format . ... Selecting the number of correlated pairs . ... In order to run thr program one needs Java 5.0 environment. ... At the end of computations one will be asked to review the selected number of correlated pairs. ... Note: One may redefine the number of correlated pairs by selecting the 'Edit' -> 'redefine correlated pairs number' menu item. Correlated pairs of positions are presented as a colored matrix, the heatmap. ...

Еще в разделе: (Показать все результаты (>146) - bioinf.fbb.msu.ru/ )

• SDPsite - Algorithm Format requirements
• RNA Kinetics: Result explanation
• Input Formats

8b44c0e4edb53491b93e3767678ded0abab721a1 # Parent 841c47a94c9e90a8d6338a5da802846c977a5f0f Backed out changeset 841c47a94c9e diff -r 841c47a94c9e -r 8b44c0e4edb5 blocks3d /wt/ blocks3d -wt.C --- a/ blocks3d /wt/ blocks3d -wt.C Wed Jan 25 00:37:52 2012 + 0400 +++ b/ blocks3d /wt/ blocks3d -wt.C Wed Jan 25 13:30:37 2012 + 0400 @@ -33,9 +33,6 @@ new Wt::WBreak( ... To calculate it, the alignment is run through Blocks3D, - which splits it to blocks. ...

Еще в разделе: (Показать все результаты (>41117) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/hg/allpy/raw-rev/841c47a94c9e
• allpy: b520e79fd1f4 allpy/markups.py
• allpy: 835efa2a8c71 allpy/markups.py

. A program for alignment of structures of DNA-protein complexes . Home . Feedback . Help . About . Input PDB code of the first complex: and chain of the protein (optional): . Input PDB code of the second complex: and chain of the protein (optional): . If you get stuck with program input, try example data and click Align! Example data . 2016

Еще в разделе: (Показать все результаты (>31) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus
• StructAlign help

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>16) - npidb.belozersky.msu.ru/ )

• NPIDB: Families of interaction class
• NPIDB: Interaction classes

System parameters on Digital UNIX . ... Digital and Cray use the number of bytes as the KIND -parameter. ... LOGICAL Default byte word KIND number = 4 1 4 LOGICAL Default double quad KIND number = 4 8 16 INTEGER int15 int31 int63 KIND number = 2 4 8 digits = 15 31 63 radix = 2 2 2 range = 4 9 18 huge = 32767 2147483647 9223372036854775807 bit_size = 16 32 64 REAL single double quad KIND number = 4 8 16 digits = 24 53 113 maxexponent = 128 1024 16384 minexponent = -125 -1021 -16381 ...

Еще в разделе: (Показать все результаты (>4931) - crydee.sai.msu.ru/ )

• The new precision concept
• Fortran and Pascal
• NAG's Fortran 90

This example continuously draws rectangles in a window and has another widget that counts the number of rectangles that are drawn per second. Id: forever.cpp,v 2.4 1998/06/16 11:39:32 warwick Exp $ ** ** Copyright (C) 1992-1998 Troll Tech AS. ... This file is part of an example program for Qt. ...

Еще в разделе: (Показать все результаты (>798) - rtm-cs.sinp.msu.ru/ )

• Qt Collection Classes
• Qt Tutorial - Chapter 5
• Descriptors and Apache

... Apache HTTP Server Version 2.0 . ... A single control process launches the number of child processes indicated by the NumServers directive at server startup. ... For each child process, Apache assesses the number of idle threads and creates or destroys threads to keep this number within the boundaries specified by MinSpareThreads and MaxSpareThreads . ... The User and Group directives are used to set the privileges of the Apache child processes. ... Maximum number of threads per child process . ...

Еще в разделе: (Показать все результаты (>983) - uneex.lorien.cs.msu.su/ )

• mod_vhost_alias - Apache HTTP Server
• HelpOnLists - UNИX
• Manual Dependencies

... Apache HTTP Server Version 2.0 . ... A single control process launches the number of child processes indicated by the NumServers directive at server startup. ... For each child process, Apache assesses the number of idle threads and creates or destroys threads to keep this number within the boundaries specified by MinSpareThreads and MaxSpareThreads . ... The User and Group directives are used to set the privileges of the Apache child processes. ... Maximum number of threads per child process . ...

Еще в разделе: (Показать все результаты (>635) - itpm.msu.su/ )

• Creating a user
• How to Dial a Number-- the dial File
• mod_vhost_alias - Apache HTTP Server

... An integer is a number of the set Z = {.. ... See also: Arbitrary precision integers and Floating point numbers . ... a = 1234; # decimal number $a = -123; # a negative number $a = 0123; # octal number (equivalent to 83 decimal) $a = 0x1A; # hexadecimal number (equivalent to 26 decimal) The size of an integer is platform-dependent, although a maximum value of about two billion is the usual value (that's 32 bits signed). ... There is no integer division operator in PHP. 1/2 yields the float 0.5 . ...

Еще в разделе: (Показать все результаты (>1474) - oit.cmc.msu.ru/ )

• number_format
• fbsql_data_seek
• mysql_data_seek

LiDIA . LiDIA is a C++ library for computational number theory which provides a collection of highly optimized implementations of various multiprecision data types and time-intensive algorithms, e.g.: . ... License Type: Free for Non-Commercial Use, ftp://ftp.informatik.th-darmstadt.de/pub/TI/systems/LiDIA/COPYRIGHT . ... An appropriated C++ - compiler and a "make" program, e.g., GNU g++ and GNU make. ... ftp://ftp.informatik.th-darmstadt.de/pub/TI/systems/LiDIA/ (FTP site) . ... SAL Home | ...

Еще в разделе: (Показать все результаты (>5239) - www.sai.msu.su/ )

• SAL- Mathematics - Number Theory - SIMATH
• FTS Dictionary Example
• SAL- Mathematics - Number Theory - ECPP

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>265) - www.genebee.msu.ru/ )

• Screening of pattern or alignment against PROTEIN databank
• OUTPUT
• Screening pattern or alignmemt against PROTEIN databank

This module provides support for dynamically configured mass virtual hosting . ... Source File: mod_vhost_alias.c . ... For simple name-based virtual hosts you might use the following directives in your server configuration file: UseCanonicalName Off VirtualDocumentRoot /usr/local/apache/vhosts/%0 . A request for http://www.example.com/directory/file.html will be satisfied by the file /usr/local/apache/vhosts/www.example.com/directory/file.html . ... Module: mod_vhost_alias . ...

Еще в разделе: (Показать все результаты (>123) - neptun.sai.msu.ru/ )

• Descriptors and Apache
• Apache module mod_status

... Numeration assumed . For this study 36 PDB-entries containing coordinates of Homeodomains were used. ... Yes . ... Drosophila melanogaster . ... X-RAY . ... MAT a 1 . ... 182 . ... 151 . ... X-ray . ... According to the gaps present in the alignment, all chains were renumbered so that after each gap the numeration begins from a new number. Thus, all aligned residues of different structures go under the same number and the gaps in the alignment do not put the numeration out. ...

Еще в разделе: (Показать все результаты (>6423) - monkey.belozersky.msu.ru/ )

• ETS numeration assumed
• About this project
• About authors ot this complex

Laboratories \ Laboratory of Avian's Ecology and Behaviour Control \ Goals and Tasks . Goals and Tasks . ... Ecology of organisms and communities . ... Bioacoustics and biolinguistics of birds . ... The number and distribution of rare bird species in Moscow Region were studied in the course of preparation of the new edition of the Red Data Book of Moscow Region. ... On the basis of the Laboratory a Research Group of Avian Ecology (RGAE) is working. ... In the Laboratory . ...

Еще в разделе: (Показать все результаты (>6628) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: number in expensive, totaled
• Экологический Форум - Фундаментальная Экология: in as number a High-end
• Экологический Форум - Фундаментальная Экология: whatever the and number largest

... Composition of infinitary structures" . Ryabov G.G. and Serov V.A. The infinitary structure of an n -cube, global k -ary trees, and natural numbers are considered as a single genetic structure. A number of geometric characteristics of the shortest paths in an n -cube are specified and the properties of prime number symmetry among the natural numbers are studied on the basis of this structure. ... PDF (Full text in Russian, References in English) (382KB) . ...

Еще в разделе: (Показать все результаты (>507) - num-meth.srcc.msu.ru/ )

• "Sets in the tool environment for developing program modules"
• Intermittency of vector fields and natural random number generators
• "Enclosure structures of equal level line fields in the gradient filling

... Programs fail after starting . ... Up: Programs fail after starting Next: HPUX Previous: Programs fail after starting . ... A: mpich has been configured to ``aggressively'' deliver messages. ... Q: My Fortran program fails with a BUS error. A: The C compiler that MPICH was built with and the Fortran compiler that you are using have different alignment rules for things like DOUBLE PRECISION . ... Up: Programs fail after starting Next: Trouble with Input and Output Previous: General . ... Центры . ...

Еще в разделе: (Показать все результаты (>765) - www.parallel.ru/ )

• MPI_Type_struct | PARALLEL.RU - Информационно-аналитический центр по
• Portable MPI Process Startup | PARALLEL.RU - Информационно-аналитический центр
• Version Number | PARALLEL.RU - Информационно-аналитический центр по