Электронная библиотека Попечительского совета . ... Loney K. - Oracle Database 10g: The Complete Reference . ... Название: Oracle Database 10g: The Complete Reference . Автор: Loney K. Аннотация: . Get a thorough understanding of Oracle Database 10g from the most comprehensive Oracle database reference on the market, published by Oracle Press. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>15014) - lib.mexmat.ru/ )

• Mullins C.S. - Database Administration: The Complete Guide to Practices and
• Maier D. - The theory of relational databases :: Электронная библиотека
• Loney K., Koch G. - Oracle8i: The Complete Reference :: Электронная библиотека

c-tree Plus(r) File Handler . Based on advanced B+tree (balanced) algorithm, c-tree Plus API handles all aspects of database I/O. Users select low-level or high-level ISAM routines for random/ sequential access. ... Program single user or multi-user non-server applications royalty free and migrate existing c-tree Plus applications to the FairCom server by recompiling. ... http://www.faircom.com/product_tech/ctree/c-tree.html . ... http://www.faircom.com/ . ... SAL Home | ... Utilities Other DBMS . ...

Еще в разделе: (Показать все результаты (>2469) - www.sai.msu.su/ )

• SAL- Database Systems - Relational DBMS - D3
• SAL- Database Systems - Relational DBMS - Oracle Products
• SAL- Database Systems - Object-Oriented DBMS - ozone

... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>1100) - oit.cmc.msu.ru/ )

• Database (dbm-style) abstraction layer functions

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4916) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>3008) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~dragon98/term3/files/megablastdis.out
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/megablastres.txt
• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_Mb.txt

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>22286) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/~smivic/Projects/Term_3/Downloads/gluq_pm.blast

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>25) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Database: . ... Affymetrix official site . ... Clone/Gene ID converter . ... Probe set search: . Affymetrix probe set identifier example: "238900_at" . ... Search . Text search: . Gene official symbol (*-wildcard) example: "c1orf*" . Word or phrase in gene official name example: "receptor" . ... Gene search: . ENSEMBL gene identifier example: "ENSG00000026508" . NCBI Entrez Gene identifier example: 7503 . HUGO gene identifier example: 1681 . ...

Еще в разделе: (Показать все результаты (>18) - mouse.belozersky.msu.ru/ )

... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>179) - www.genebee.msu.ru/ )

Counting Stars in the Infrared Sky . ... Credit Copyright: J. Carpenter , M. Skrutskie , R. Hurt , 2MASS Project , NSF , NASA Explanation: The bulging center of our Milky Way Galaxy , dark cosmic clouds, the thin galactic plane, and even nearby galaxies are easy to spot in this sky view. But each pixel in the digital image is actually based on star counts alone -- as derived from the Two Micron All Sky Survey (2MASS) database. ... U. Based on Astronomy Picture Of the Day ...

Еще в разделе: (Показать все результаты (>4249) - www.astronet.ru/ )

• Counting Stars in the Infrared Sky
• A Complete Solar Cycle from SOHO
• A Complete Aurora

Natural Satellites Data Center NSDC . ... Natural Satellites Ephemerides Server MULTI-SAT. ... OF NATURAL PLANETARY SATELLITES. ... A light movement of your arm ... and all necessary data are instantly available on your computer screen. ... New orbital models for all the new faint satellites of Jupiter, Saturn, Uranus and Neptune were determined independently from other authors on the basis of all published observations using numerical integration method applied to the equations of satellites motions. ...

Еще в разделе: (Показать все результаты (>185) - lnfm1.sai.msu.ru/ )

• Data bases of Natural Satellites. Documentation. Structure

... Protein sequences . ... European ribosomal RNA database . ... Thermodynamic database for protein-nucleic acids interactions (Japan) . ... Families of structurally similar proteins . ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering complete protein sequences. ... Database issues of NAR: vol. 31 (2003) , vol. 32 (2004) , vol. 33 (2005) , vol. 34 (2006) , vol. 35 (2007) , vol. ...

Еще в разделе: (Показать все результаты (>4465) - monkey.belozersky.msu.ru/ )

• PLANdbAffy main

... About lab . ... Multiple object detection . ... Online Journal "Computer graphics and multimedia" (in russian) . ... To detect multiple objects of interest, the methods based on Hough transform use non-maxima supression or mode seeking in order to locate and to distinguish peaks in Hough images. ... Iterations of the Hough-like algorithm for multiple object instances detection: . ... Barinova O, Lempitsky V, Kohli P. On detection of multiple object instances using Hough transform . ...

Еще в разделе: (Показать все результаты (>303) - graphics.cs.msu.ru/ )

• Automatic building texture completion | Graphics and Media Lab
• Selected completed projects | Graphics and Media Lab
• Automatic building texture completion | Лаборатория компьютерной графики и

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

... Return status . ... However, this information is not directly available as a field of the status variable and a call to MPI_GET_COUNT is required to ``decode'' this information. MPI_GET_COUNT(status, datatype, count) . ... int MPI_Get_count(MPI_Status *status, MPI_Datatype datatype, int *count) . ... All send and receive operations use the buf, count, datatype, source, dest, tag, comm and status arguments in the same way as the blocking MPI_SEND and MPI_RECV operations described in this section. ...

Еще в разделе: (Показать все результаты (>721) - www.parallel.ru/ )

• MPI_Testany | PARALLEL.RU - Информационно-аналитический центр по параллельным
• MPI_Waitall | PARALLEL.RU - Информационно-аналитический центр по параллельным
• MPI_Testall | PARALLEL.RU - Информационно-аналитический центр по параллельным

As it was already mentioned, the idea behind File Juggler is rather simple: using CGI scripts as processing tools and WWW browser as user interface, display the structure and content of typical anonymous FTP server in a convenient, easily navigated form. ... My P5-133 spends about 0.025 ms on one file when doing linear search with simple criterion (690 ms for 27,000 files, search for substring among file names/descriptions with 70 hits). ... Let's now look whether we can handle 1,000,000 files. ...

Еще в разделе: (Показать все результаты (>3210) - crydee.sai.msu.ru/ )

• Argument association
• Keyword arguments and default arguments
• Index of /ftproot/pub/comp/os/os2/leo/database

... Temporarily make the "mw-config" directory writable to the user the web server is running as. ... So, please, read the following link and find solution which suits your needs best: http://www.mediawiki.org/wiki/Manual:Installing_MediaWiki#Create_a_database 3. ... After the setup script has finished running successfully, a file called LocalSettings.php is created in the "mw-config" directory. Move this file to the root wiki directory (${MY_INSTALLDIR}): $ mv mw-config/LocalSettings.php . ...

Еще в разделе: (Показать все результаты (>18366) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/www-apps/coppermine/files/postinstall-en.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc3401.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc3401.txt

... The following options are not normally used on a day to day basis. ... cd /var/lib/rpm # ls total 3534 -rw-r--r-- 1 root root 1351680 Oct 17 10:35 fileindex.rpm -rw-r--r-- 1 root root 16384 Oct 17 10:35 groupindex.rpm -rw-r--r-- 1 root root 16384 Oct 17 10:35 nameindex.rpm -rw-r--r-- 1 root root 2342536 Oct 17 10:35 packages.rpm -rw-r--r-- 1 root root 16384 Oct 17 10:35 providesindex.rpm -rw-r--r-- 1 root root 16384 Oct 17 10:35 requiredby.rpm # . ... you already have an RPM database. ...

Еще в разделе: (Показать все результаты (>486) - uneex.lorien.cs.msu.su/ )

• htdbm - Manipulate DBM password databases - Apache HTTP Server
• Initalize Database Mode
• Rebuild Database Mode

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>6) - ecoinformatica.srcc.msu.ru/ )

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>6) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.