... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>4797) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/blasn.out

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>31576) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/~element/Term3/blast_3.txt

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>34) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Oracle Products . The availablility of Oracle products on Linux will enable users of Linux to deploy enterprise class applications with unparalleled performance at the lowest possible cost. ... Oracle currently has following products available for Linux: . WebDB -- complete and cost-effective solution for building, deploying, and proactively monitoring Web database applications and content-driven Web sites. ... Oracle8 Server -- database management system. ... SAL Home | ... Relational DBMS . ...

Еще в разделе: (Показать все результаты (>2687) - www.sai.msu.su/ )

• SAL- Database Systems - Object-Oriented DBMS - ROL
• SAL- Database Systems - Utilities Other DBMS - c-tree Plus
• SAL- Database Systems - Utilities Other DBMS - barracuda

Электронная библиотека Попечительского совета . ... Loney K. - Oracle Database 10g: The Complete Reference . ... Название: Oracle Database 10g: The Complete Reference . Автор: Loney K. Аннотация: . Get a thorough understanding of Oracle Database 10g from the most comprehensive Oracle database reference on the market, published by Oracle Press. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>16504) - lib.mexmat.ru/ )

• Mullins C.S. - Database Administration: The Complete Guide to Practices and
• Lewis H.G. - Effective E-Mail. The Complete Guide to Creating Successful
• Riordan R.M. - Designing effective database systems :: Электронная библиотека

... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>252) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.8 Services Help
• GeneBee BLAST 2.2.22+ Services Help

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4919) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page

... Protein sequences . ... European ribosomal RNA database . ... Thermodynamic database for protein-nucleic acids interactions (Japan) . ... Families of structurally similar proteins . ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering complete protein sequences. ... Database issues of NAR: vol. 31 (2003) , vol. 32 (2004) , vol. 33 (2005) , vol. 34 (2006) , vol. 35 (2007) , vol. ...

Еще в разделе: (Показать все результаты (>1282) - monkey.belozersky.msu.ru/ )

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>6964) - mouse.belozersky.msu.ru/ )

... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>628) - oit.cmc.msu.ru/ )

• Apache module mod_auth_anon.c
• How Directory, Location and Files sections work
• Database issues

... We introduce a new approach to database disk buffering, called the LFU-K method. The LFU-K page replacement algorithm is an improvement of the Least Frequently Used (LFU) algorithm. A probability-theoretical model for a formal description of the LFU-K algorithm is proposed. ... As we demonstrate with trace-driven simulation experiments, the LFU-2m algorithm performs better than the conventional buffering algorithm for the shared-nothing database system workloads. ...

Еще в разделе: (Показать все результаты (>143) - num-meth.srcc.msu.ru/ )

Technical aspects of the search for anomalous Wtb couplings. ... Outline What we call anomalous Wtb couplings Operators and vertex approaches Anomalous couplings in production cross section Anomalous couplings in the decay of top quark Effective operators in the field theory: In the units where = c = 1, the fields of the SM have mass dimensions: scalar: vector: fermion: Every term ... Problems of vertex function approach: We use operators with different mass dimensions. ...

Еще в разделе: (Показать все результаты (>197) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2013/Bunichev_QFTHEP2013.pdf

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>167) - www.fadr.msu.ru/ )

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

• Best search engines for finding scientific information in the Internet:
• XAFS Publication Database search form

You can search database for submitted information. ... Character * specifies arbitrary character sequence (eg. '*n' will result: John, Martin etc.) Character * is placed at end of line automatically ('Mar*' = 'Mar' will result: Martin, Martina etc.) Blank form will result ALL database records. ... Family name: . ... Topic: . ... Seismo-tectonics of Tsunami 3. Numerical and Analytical Models of Local Tsunami Behavior 4. ... Recent Local Tsunamis 8. ... Information . ... Database search . ...

Еще в разделе: (Показать все результаты (>30) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Official information

Home . ... Activities . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Image enhancement . ... Rank image filtering . Image analysis . ... Ringing effect . ... Database . ... Medical imaging . ... Multiresolution analysis and processing . ... The final version of the developed ringing database is available here: . ... The ringing extension of TID 2013 database: . ...

Еще в разделе: (Показать все результаты (>157) - imaging.cmc.msu.ru/ )

• Ringing effect modeling | Laboratory of Mathematical Methods of Image...
• Ringing analysis | Laboratory of Mathematical Methods of Image Processing
• Research | Laboratory of Mathematical Methods of Image Processing

Copyright 1999-2015 Gentoo Foundation # Distributed under the terms of the GNU General Public License v2 # $Id$ EAPI=5 inherit bash- completion -r1 prefix toolchain-funcs DESCRIPTION= Programmable Completion for bash HOMEPAGE= http://bash- completion .alioth.debian.org/ SRC_URI= http://bash- completion .alioth.debian.org/files/${P}.tar.bz2 LICENSE= GPL-2 SLOT= 0 KEYWORDS= ~alpha amd64 arm ~arm64 hppa ...

Еще в разделе: (Показать все результаты (>19461) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/app-shells/bash-completion/bash-completion-1.3-r2.ebuild
• http://mirror.msu.net/pub/gentoo-portage/www-apps/mediawiki/files/postinstall-1.18-en.txt
• http://mirror.msu.net/pub/gentoo-portage/www-apps/coppermine/files/postinstall-en.txt

Maximum RPM: Taking the Red Hat Package Manager to the Limit . ... the section called The Package Label ? Verify an Installed Package Against the RPM Database . ... Verify the Package Owning <file> Against the RPM Database . ... Verify all installed packages . ... Verify All Installed Packages Against the RPM Database . ... Verify packages belonging to group <group> . ... It would be handy if RPM did nothing more than verify that every file installed by a package actually exists on your system. ...

Еще в разделе: (Показать все результаты (>593) - uneex.lorien.cs.msu.su/ )

• Miscellania
• Configuration Sections - Apache HTTP Server
• Online Support Sections

The sections <Directory> , <Location> and <Files> can contain directives which only apply to specified directories, URLs or files respectively. Also htaccess files can be used inside a directory to apply directives to that directory. ... The order of merging is: . ... If multiple <Directory> sections apply to the same directory they are processed in the configuration file order. ... Using the options in question is only possible inside a <Directory> section (or a .htaccess file). ...

Еще в разделе: (Показать все результаты (>93) - neptun.sai.msu.ru/ )

• Apache module mod_auth_anon.c
• Apache Tutorial: .htaccess files

This module is contained in the mod_auth_anon.c file and is not compiled in by default. It is only available in Apache 1.1 and later. It allows "anonymous" user access to authenticated areas. It does access control in a manner similar to anonymous-ftp sites; i.e. have a 'magic' user id 'anonymous' and the email address as a password. ... This would allow the user to enter without password verification by using the userId's 'anonymous', 'AnonyMous','Not Registered' and 'I Don't Know'. ...

Еще в разделе: (Показать все результаты (>654) - rtm-cs.sinp.msu.ru/ )

• How Directory, Location and Files sections work
• Qt Toolkit - QNPStream Class
• Migrating Objects