... Online Services | ... CDFE => Online Services => Chart of Nucleus Shape Parameters . Nucleus quadrupole deformation parameter ? ... At.Data Nucl.Data Tables 78, 1 (2001)] . ... N.J.Stone, At.Data Nucl.Data Tables, 90 75 (2005)] . ... Nucleus charge radii: . ... Nadjakov E. G., Marinova K. P. and Gangrsky Y. P., At.Data Nucl.Data Tables, 56, 133(1994)] (updated 2015) . ... I. Angeli, At.Data Nucl.Data Tables, 87, 185 (2004), updated 2008] . ... CDFE Head: Vladimir V. Varlamov . ...

Еще в разделе: (Показать все результаты (>57) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Nucleus Ground State Parameters
• CDFE => Online services => Chart of Nuclear Quadrupole Deformations
• CDFE - Centre for Photonuclear Experiments Data - Home page

... Государственный Астрономический Институт имени П.К. Штернберга МГУ . ... Семинары ГАИШ . ... Государственный астрономический институт им. П.К.Штернберга (ГАИШ) научно-исследовательский институт, являющийся одним из подразделений МГУ им. М.В. Ломоносова . ... 11 декабря 2006 года исполнилось 175 лет со дня создания на Пресне Астрономической обсерватории Московского университета, ставшей впоследствии базой для формирования Государственного астрономического института им. П.К. Штернберга (ГАИШ МГУ). ...

Еще в разделе: (Показать все результаты (>105) - sai.msu.ru/ )

SAI 175 anniversary . ... Moscow University . Search for in SAI Moscow University Search for in Russian astronomical resources . ... SAI Astronomical Databases . ... Browse SAI Software archive(ftp.sai.msu.su) . ASTRONET.RU - Russian Astronomical Network (available in translit also) . ... SAI Supernovae Research Group . ... Department of the Galaxy and Variable Stars (in Russian) . Sternberg Astronomical Institute Seminars . ... All-Russian Astronomical Olympiad (in Russian) . ...

Еще в разделе: (Показать все результаты (>1186) - www.sai.msu.su/ )

• SAI SN RESEARCH GROUP

... 18 27 апреля 2016 года . ... СЕМИНАР ПО МЕХАНИКЕ СПЛОШНЫХ СРЕД . В среду, 13 апреля 2016 г., в кинозале Института механики МГУ в 12.00 состоится очередное заседание семинара по механике сплошных сред под руководством А.Г. Куликовского, В.П. Карликова и О.Э. Мельника. ... версия для печати 2016-04-07 . ... 260 заседание семинара ?Физико-химическая кинетика в газовой динамике? состоится в четверг 07 апреля 2016 года (11 часов, кинозал Института механики МГУ) . ... НИИ механики МГУ, 2002 2016. ...

Еще в разделе: (Показать все результаты (>4) - www.imec.msu.ru/ )

... Calculations of at least two runs with different values of a parameter are required in order to discover to what extent the results depend on the , if at all. ... In order to study how the final statistical distributions depend on the initial functions, the method of Green functions is used. ... Then we can restore any distribution on this parameter (with a certain accuracy) by summing the results for each interval with the appropriate weight. ...

Еще в разделе: (Показать все результаты (>632) - xray.sai.msu.ru/ )

• Initial Distributions of Binary Parameters
• Parameters of binary compact star evolution
• Restrictions on the Scenario Parameters

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Algorithms for calculating parameters of virtual scenes in computer vision tasks . ...

Еще в разделе: (Показать все результаты (>242) - graphics.cs.msu.ru/ )

THE PHOTOMETRIC RESEARCHS OF THE MERCURY'S SURFACE BY MEANS OF DIGITAL MODELS. ... The surface brightness of Mercury was measured Danjon (1933, 1949, 1953) and Harris (1961) in phase angle 3o-123o. The analysis of the various data of the integral photometric gives the results of determination of the main photometric constants for Mercury. ... THE PHOTOMETRIC RESEARCHS OF THE MERCURY'S SURFACE: S.G. Pugacheva The surface brightness of the Mercurian images was established on the geologic map Mercury. ...

Еще в разделе: (Показать все результаты (>125) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Pug/Publications/ms42/m42_60.pdf
• Svetlana G. Pugacheva

... Among the methods of theoretical investigation of coordination compounds, molecular mechanics seems to be an optimal choice. However, conventional MM force fields typically do lack metal-related force field parameters. ... Let us calculate (MM) energy gradient for experimental structures using purely organic force field with no metal-dependent terms. ... In other words, thus calculated forces give an "imprint" for the derivation of metal-dependent forces. ...

Еще в разделе: (Показать все результаты (>740) - chem.msu.ru/ )

• Comparative Analysis of Intramolecular Parameters of Nitrocompounds:
• Molecular mechanics calculations of beta-diketonate, aqua, and
• Optimization of Optical Scheme Parameters in Dual-Beam Thermal Lens...

... The Influence of Microstructure of Media on Nonlinear Acoustic Parameter of Solutions . ... The acoustic nonlinear parameter B/A is strongly structure sensitive as it was shown in [Lesnyanskii et al. ... The values of parameters (Ye/Yid and derivative Ye with respect to pressure) are calculated from offered method [Balankina E.S. Proceeding of XI Session of the Russian Acoustic Society, Moscow, 2001 (http://www.akin.ru/RAO/sess11)] using volumetric-elastic properties of solutions. ...

Еще в разделе: (Показать все результаты (>665) - acs366.phys.msu.su/ )

• AUTHOR : Trivett D
• AUTHOR : Rogers P
• AUTHOR : Pincon H

const int nvar_ is a number of independent physical parameters involved in the evaluation of squared matrix element. const int nfunc_ is a number of constrained parameters involved in the evaluation of squared matrix element. int calcFunc(void) calculates all constrained parameters for current values of independent ones. It returns 0 in the case of success, otherwise 1. int vinf_(int numvar, char *name, double *val) provides the information about parameters. ... It returns if , or otherwise. ...

Еще в разделе: (Показать все результаты (>1504) - theory.sinp.msu.ru/ )

• Widths implementation parameters
• [RU-NGI] GLUE2 parameters
• M.Z. Iofa Curriculum vitae.

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... ELFIN-L . ... It consist of a Flux Gate Magnetometer (FGM), an Energetic Particle Detector for Electrons (EPDE), and an Energetic Proton Detector for Ions (EPDI). ... Energetic particles create a hazardous environment for satellites and humans in space and cause a number of satellite failures. ... Magnetospheric particles and radiation environment . ...

Еще в разделе: (Показать все результаты (>62) - lomonosov.sinp.msu.ru/ )

• DEPRON | Университетский спутник "Ломоносов"
• Information unit (BI) | Университетский спутник "Ломоносов"
• TUS | Университетский спутник "Ломоносов"

... Publications . ... Number of publications 0 . ... Publication type . ... Borisov A. V. , Kazakov A. O. , Sataev I. R. The Reversal and Chaotic Attractor in the Nonholonomic Model of Chaplygin?s Top . Regular and Chaotic Dynamics, 2014, vol. 19, no. 6, pp. ... Borisov A. V., Kazakov A. O., Sataev I. R., Regular and Chaotic Attractors in the Nonholonomic Model of Chapygin's ball, Russian Journal of Nonlinear Dynamics, 2014, vol. 10, no. 3, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>220) - ics.org.ru/ )

CALCULATION OF THE PARAMETERS OF MICROSCOPIC OPTICAL POTENTIAL BY ASYNCHRONOUS DIFFERENTIAL EVOLUTION ALGORITHM Zhabitskaya E.I ., Zhabitsky M.V.1 , Zemlyanaya E.V., Lukyanov K.V. Dubna University, Russi, Dubn; Joint Institute for Nuclear Research, LIT, Russia, Dubna ,141980, Joliot-Curie 6 Joint Institute for Nuclear Research, LNP, Russia, Dubna ,141980, Joliot-Curie 6; Rock Flow Dynamics, Russi, Moscow 1 Differential ... J. of Global Optimization 11,1997, Pp. ...

Еще в разделе: (Показать все результаты (>309) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc18923/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc101227/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc24959/eng.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

New achievements in Development of Multidimensional Data Acquisition, Processing and Visualization DAQPROVIS M. MorhА *, 1, 2 , V. Matousek 1, 2 1, 3 , J. Kliman 1, 2 , 1 Institute of Physics, Slovak Academy of Sciences, Bratislava, Slovakia 2 Flerov Laboratory of Nuclear Reactions, JINR, Dubna, Russia 3 Laboratory of High Energies, JINR, Dubna, Russia * E-mail: morhac@savba.sk ACAT - 2002 I. Turzo c 1, 3 , . ... The channels are displayed as balls. ... Four-parameter experimental spectrum. ...

Еще в разделе: (Показать все результаты (>70) - acat02.sinp.msu.ru/ )

Электронная библиотека Попечительского совета . ... Bishwal J.P. - Parameter Estimation in Stochastic Differential Equations . ... Название: Parameter Estimation in Stochastic Differential Equations . ... Parameter estimation in stochastic differential equations and stochastic partial differential equations is the science, art and technology of modelling complex phenomena and making beautiful decisions. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>7950) - lib.mexmat.ru/ )

• Englezos P., Kalogerakis K. - Applied parameter estimation for chemical
• Fasshauer G.E., Zhang J.G. - On choosing 'optimal' shape parameters for RBF
• Поиск книг, содержащих Однопараметрическая подгруппа (one parameter subgroup)

... When using a multidimensional parameter space, it is often impossible to establish frame bounds daubechies:CBMS on the energy in the parameter space. With only one parameter, we cannot always reconstruct the signal. ... To the extent that multi-dimensional parameter spaces are still useful, we will not let this infinite energy hinder our progress...``time-frequency-scale-chirprate . ... In general, g ( t ) is a complex-valued function of a real variable, and has finite energy: 6#6... affine . ...

Еще в разделе: (Показать все результаты (>730) - crydee.sai.msu.ru/ )

• Tutorial on Fortran 90, Digital UNIX
• Notation
• SunSoft

... (experiment) Optical: 2 3 *) CBP Conclusion: the ET in OLED active centers is mainly associated with local molecular modes , rather than with medium polarization modes , as in usual ET theories 2 *) V. Ruhle et al, JCTC 7 (2011) 3335-3345 2 ... Active ET local motions: Reorganization mode X (intramolecular) Transfer integral: n J nn ^ = J 0 n ( X ) J X n ( X ) d ^ J X = exp - (shift operator ) dX (X) are oscillator functions: J nn = J 0 n ( X ) | ... Includes the Kubo function f(z). ...

Еще в разделе: (Показать все результаты (>21) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/kiselev.pdf

... Next: Plane tab Up: Client Previous: Connection to a Server Contents Index . Figure 2.4: Scan parameters. STM mode of operation. ... AFM mode of operation. ... All scan parameters can be configures in Parameters window (pic. ... Client part of `` FemtoScan '' software allows to control microscope operating in three different scanning modes - tunneling mode(STM), atomic-force mode (AFM) and resonance atomic-force (RAFM). ... It(Z) tab (STM mode), F(Z) tab (AFM mode), D(Z) tab (RAFM mode). ...

Еще в разделе: (Показать все результаты (>142) - www.spm.genebee.msu.ru/ )

• Parameters of 3D Images
• Microscope Parameters Data
• Plane tab

... transaction-id,initial-requester-id,person-or-institution-symbol,person . ... transaction-id,initial-requester-id,name-of-person-or-institution,name-of-person . transaction-id,initial-requester-id,name-of-person-or-institution,name-of-institution . ... delivery-address,postal-address,name-of-person-or-institution,name-of-person . delivery-address,postal-address,name-of-person-or-institution,name-of-institution . ... billing-address,postal-address,name-of-person-or-institution,name-of-person . ...

Еще в разделе: (Показать все результаты (>527) - oit.cmc.msu.ru/ )

• Dealing with a Variable Number of Arguments/Optional Parameters
• Assuring Write Safety for Other Parameters
• pdf_set_parameter