. General Information . News . Organizing Committee . Program . Registration . Registered participants . Symposium expenses . Accommodation and meal . Important deadlines . Presentation information . Abstract submission . Cultural Program . Travel information . Contact information . 14 European Symposium on . Gas Phase Electron Diffraction . 24-28 June 2011 . M. V. Lomonosov Moscow State University . 1 February 2011 . deadline for Registration . 20 April 2011 . deadline for Abstract submission .

Еще в разделе: (Показать все результаты (>15) - ged.chem.msu.ru/ )

• General Information. 14 European Symposium on Gas Phase Electron Diffraction

... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...

Еще в разделе: (Показать все результаты (>3) - sun.sai.msu.ru/ )

... Also during this work Dian drank a lot of tea with sugar, completed his description of urban and rural life (to the tunes of world-known musical "Notre-Dame de Paris"), wrote several poems about his dear friend GVR. ... Besides this project, Sergei A. Spirin with his colleague Andrew V. Alexeevski takes a very great part in different researches. Near their work room on the 3rd floor of the "A" laboratory building, near with the biological one, different colourful posters can be watched. ...

Еще в разделе: (Показать все результаты (>788) - monkey.belozersky.msu.ru/ )

• Yeast intein-encoded LAGLIDADG homing endonucleases
• About this project
• Inquiry information || Parsimony algorithm

... Graduated from M.Lomonosov Moscow State University, Department of Mechanics and Mathematics. Dissertation's title of Ph.D. (Phys.& Math): "Aerodynamic Characteristics, Shape-Formation and Stressed-Strained State of Parachute Canopy." ... Graduated from M.Lomonosov Moscow State University, Piano Class. ... Development of mathematical models and parameter computation methods for the shape, aerodynamic drag and stressed-strained state of parachutes with different canopy geometry. ...

Еще в разделе: (Показать все результаты (>6) - margaret.imec.msu.ru/ )

• Large-Scale Load Stabilization
• Homepage

. This document is designed to be viewed using the frames feature. If you see this message, you are using a non-frame-capable web client. Link to Non-frame version.

Еще в разделе: (Показать все результаты (>41) - angel.cs.msu.su/ )

• Copyright 1997 University Corporation for Atmospheric Research, Boulder,
• Foreword
• PhD Summer School on Scentific Computing

Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...

Еще в разделе: (Показать все результаты (>5) - newcryst.phys.msu.ru/ )

• Поиск новых кристаллических материалов, исследование их свойств и процессов

... Superoxide dismutase (SOD, EC 1.15.1.1) and catalase (CAT, EC 1.11.1.6) together with low-molecular mass antioxidants act as the main defense against ROS produced in various parts of plant cells. ... For investigation of enzyme (SOD, CAT and PAL) activity were used 17 day leaves of controlled and treatment plants. ... ilshat.rafkatovitch@gmail.com - in vitro , 302 . ... H2O2 , H2O2 , H2O2 . ... H2O2- , , . ... 307 Tribulus terrestris L. , .., , , handy_89@mail.ru in vitro . ... PepP Synechocystis sp...

Еще в разделе: (Показать все результаты (>14) - plantphys.bio.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Semantic Resources for Textual Content Compression

... DEVELOPMENT OF EXPLICIT CYCLIC SCHEMES . WITH CHEBYSHEV?S POLYNOMIALS FOR SPACE NEUTRON KINETICS . ... Questions have been studied to use effectively explicit schemes for solving spatial kinetics. ... Algorithms have been developed to solve spatial kinetic equations on the basis of explicit cyclic schemes with time varying steps designed by V.I. Lebedev [1] as well as schemes of local iterations proposed by O.V. Lokutsievskiy and V.O. Lokutsievskiy [2]. ... Code development. ...

Еще в разделе: (Показать все результаты (>83) - sp.cs.msu.ru/ )

• BlueBookImplementationTOC
• Development of portable program system
• Темы докладов, курсовых и дипломных работ. 1998-1999 учебный год

. Name . Last modified . Size . Description . Parent Directory . - . Apache/2.2.16 (Debian) Server at uneex.mithril.cs.msu.su Port 80

Еще в разделе: (Показать все результаты (>185) - uneex.mithril.cs.msu.su/ )

• HelpOnLinking - UNИX
• PspoMaterials/AltDocs_licenses_research_2004 - UNИX
• HelpOnInstalling/ApacheWithModPython - UNИX

... heat and mass transfer; . kinetic theory of gases; . ... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...

Еще в разделе: (Показать все результаты (>10) - lab106.imec.msu.ru/ )

... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...

Еще в разделе: (Показать все результаты (>12) - biophys.msu.ru/ )

• CURRICULUM VITAE
• Photo-induced delayed luminescence
• C U R R I C U L U M V I T A E

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>4) - sinp.msu.ru/ )

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

... Memory is a key resource in desktop computer. ... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate key Win 7 ultimate product key windows 7 key sale win 7 ultimate product Key Windows 7 key ultimate win 7 ultimate ...

Еще в разделе: (Показать все результаты (>115) - elana.sinp.msu.ru/ )

• ralph lauren outlet uk 6 million cars worldwide | С Днем Победы!
• the north face outlet uk Legner said that companies should provide an automated
• If you would like to to buy some great authentic vintage Chanel purses for

... N.M. Emanuel Institute of Biochemical Physics, Russian Academy of Sciences . A.N. Bach Institute of Biochemistry, Russian Academy of Sciences . Advanced Biomedical Computing Center , National Cancer Institute at Frederick, MD, USA . Department of Chemistry, University of Southern California , Los Angeles, CA, USA . Department of Biomolecular Mechanisms, Max-Planck Institute for Medical Research, Heidelberg, Germany . ... Joint Supercomputer Center of the Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>20) - lcc.chem.msu.ru/ )

• Laboratory of Chemical Cybernetics
• History

... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...

Еще в разделе: (Показать все результаты (>2) - lib.sinp.msu.ru/ )

ITPM MSU . Quantum Computing Page . ... Quantum Computation/Cryptography at LosAlamos . Quantum Information at Los Alamos National Laboratory . Laboratory for Theoretical and Quantum Computing ( Universite de Montreal ) . Quantum information and quantum computation at IBM . ... Centre for Quantum Computation . Quantum Information Page . Quantum Information and Computation . ... Quantum Information and Quantum Computing (by Reinhard F. Werner) . ... c) ITPM MSU 1998, 1999 ...

180. Background? Faculty of Bioengineering and Bioinformatics, MSU