... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... During the round table, NAMMI and Lomonosov Moscow State University were represented by Sergey Smirnov, associate professor of the Faculty of Journalism of Lomonosov Moscow State University. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>66) - www.journ.msu.ru/ )

Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Moscow, 2008 Acknowledgements A.Belinskiy M.Kornilov A.Tokovinin M.Kuznetsov P.Kortunov E.Gorbovskoy SAI administration some SAI students Pulkovo solar station (KHSS) staff RFBR support MAVEG Gmbh Why to study optical turbulence and some other relevant ... Mean seeing by DIMM data for this night is 1''5. ...

Еще в разделе: (Показать все результаты (>23) - curl.sai.msu.ru/ )

• atmos 3.0 page

... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...

Еще в разделе: (Показать все результаты (>30) - phys.web.ru/ )

... Студенты, обладающие визой F-1 в Соединенных Штатах Америки , теперь могут сделать изменения, объявленные в апреле, в программе Общего практического обучения. Срок программы обучения был продлен от 12 месяцев до 29 и теперь позволяет определенным студентам визы F-1 работать в США по профессиям, относящимся к области обучения студентов. ... Data Processing and Data Processing Technology/Technician. ... Architectural Engineering Technology/Technician. ... Civil Engineering Technology/Technician. ...

Еще в разделе: (Показать все результаты (>517) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Конференция "Вакансии"
• Клуб выпускников МГУ: Обсуждение материала "CRISIS IN THEORETICAL PHYSICS: THE
• Клуб выпускников МГУ: "ЛЕН-КАРТОФЕЛЬ-ДИЕТА И ГЕНОФОНД ЧЕЛОВЕКА"

... Basic Linux . ... PCMCIA . Sound . ... CLEVO 8750 running X Window . ... BIOS: Phoenix (256Kb Flash ROM, PnP 1.0a, APM 1.2, LBA) LCD: TFT 13.3" 1024x768 . ... PCMCIA: GL9382; 2x Type II or 1x Type III PC Card slots (with ZV support) . ... Battery: Ni-Mh or Li-Ion . ... Nor X Window neither PCMCIA worked. ... For CLEVO 8750, I found at least two RRs at which X Window works: 62Hz and 70Hz. ... To enable the mouse when working on console use GPM with "-dev/psaux -t ps2" options. ...

Еще в разделе: (Показать все результаты (>17) - uranus.sai.msu.ru/ )

• Anatol Cherepashchuk
• Igor Antokhin
• Tatjana Khruzina

... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...

Еще в разделе: (Показать все результаты (>7) - margaret.imec.msu.ru/ )

• On Square Parachute Differential Equations

... Further processing Only 3N events of «good» runs of previous analysis are selected: 3N triggered events exist in every run Better accordance with MC for rates 150kHz (see elog 548 by Colas) GC triggered events excluded AaFit: -6.5 (Vladimir's presentation explains reason) Zenith angle 20° (in order to look only at events with vertical tracks) After 2008 2009 2010 all fi year year year ltres: -- 0.83107 -- 0.77107 -- 1.04107 - No evidence of possible anisotropy either. ...

Еще в разделе: (Показать все результаты (>27) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/Anisotropy_2011Bamberg.pdf
• http://antares.sinp.msu.ru/seminar/Kulikovskiy.pdf
• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%202.pdf

... Furman and A.V.Tikhonravov, "Basics of optics of multilayer systems" , Editions Frontiers, Gif-sur Yvette, 1992, 242 p. A.V. Tikhonravov, M.K. Trubetskov, I.V. Zuev and P.G. Verly, "Efficient Refinement of Inhomogeneous Optical Coatings", in "Optical Interference Coatings", OSA Technical Digest Series, vol. ... A.V. Tikhonravov, M.V. Klibanov, I.V. Zuev, "Numerical study of the phaseless inverse scattering problem in thin film optics", Inverse problems, 1995, Vol. 11, pp. ... Основные публикации . ...

Еще в разделе: (Показать все результаты (>30) - www.srcc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...

Еще в разделе: (Показать все результаты (>4) - newcryst.phys.msu.ru/ )

. Please standby and you will be automatically connected to the new location of the unframed Supernova page. Or, click on the link above. If you have questions or problems, please email me at David Bishop dbishop@vhdl.org . Last modified: Mon Aug 27 12:40:15 EDT 2001

Еще в разделе: (Показать все результаты (>26) - www.rochesterastronomy.org/ )

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Higher School of Management and Innovation (Faculty of Lomonosov MSU) was founded in June 2006 by the Academic Council on the initiative of the Moscow State University Rector, academician V.A. Sadovnichiy and Chairman of the Board of Directors of JSFC "Sistema" V.P. Yevtushenko. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>7) - hsmi.msu.ru/ )

• Project and Process Management | MSU Higher school of management and innovation

SITE 2010 Comprehensive Characterization of Astronomical Sites Kislovodsk, Russia, 49 October 2010 Conference Summary Marc S. Sarazin*a a European Southern Observatory, Garching, Germany Abstract The main topics discussed during the Site 2010 conference are outlined and the outcome is described. Keywords: Astronomical Site testing, precipitable water vapor, atmospheric turbulence, cloudiness, seeing 1. ... Site surveys for National observatory projects in China, India, and Iran benefit from this. ...

Еще в разделе: (Показать все результаты (>23) - site2010.sai.msu.ru/ )

• http://site2010.sai.msu.ru/static/doc/TTravouillon_TMT_site_testing_site2010.pdf
• http://site2010.sai.msu.ru/static/doc/VKornilov_site2010.pdf
• http://site2010.sai.msu.ru/static/doc/GHerriot_site2010.ppt.pdf

Combination of high resolution mass -spectrometry (FT-ICR) and nuclear magnetic resonance ( NMR ) for analysis of mumijo (shilajit) Gleb Vladimirov1, Anton Grigoryev1,5, Alexey Kononikhin1,2, Norbert Hertkorn4, Andrey Konstantinov3, Irina Perminova3, Igor Popov1.2, Eugene Nikolaev1,2 Institute For Energy Problems of Chemical Physics RAS, Moscow , Russia Institute of Biochemical Physics RAS, Moscow , Russia 3 Lomonosov Moscow State University, ...

Еще в разделе: (Показать все результаты (>155) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2008/2008-kononikhin-characterization.pdf
• http://www.mgumus.chem.msu.ru/publication/2010/2010-kazachkov-optimization.pdf
• http://www.mgumus.chem.msu.ru/publication/2009/2009-kunenkov-total.pdf

THE THIRD ANNUAL STUDENTS' SCIENTIFIC CONFERENCE ON TODAY'S TOPICAL POLITICAL AND PHILOSOPHICAL ISSUES Panel of philosophy ALEXANDER BOURGANOV AND HIS `NEW ROMANTICISM' CONCEPTION Liyamina Anastasiya Faculty of philosophy 1st year student Alexander N. Bourganov occupies an important place among famous masters of modern sculpture. ... He tries to find philosophical foundation for mathematics. ... Existential dread is examined by Kierkegaard in his work "The concept of anxiety". ...

Еще в разделе: (Показать все результаты (>102) - ffl.msu.ru/ )

• http://www.ffl.msu.ru/future-students/lingua-4-teens/tez.pdf
• http://www.ffl.msu.ru/faculty/departments/english-for-humanities/tezis.doc

МГУ имени М.В.Ломоносова Русская версия . ... Science calendar . ... World Politics . ... Associate professor, Deputy Dean for scientific research, Faculty of World Politics, Candidate of historical science . ... Associate Professor, the Department of Regional Problems of World Politics, Candidate of historical science . ... Naumkin Vitaly V. - Corresponding Member of the Russian Academy of Sciences, Professor, Head of the Department Regional Issues of World Politics, Doctor of historical science . ...

Еще в разделе: (Показать все результаты (>24) - conf.msu.ru/ )

The Laboratory of the Historical Information Science . ... The historical information science laboratory was founded within the structure of the source studies department on 8 December 1995 for the purpose of fulfilling the decision of the academic council of the History Faculty of 4 October 1991 about the transformation of a group for the application of mathematic methods and mainframes in historical research in the laboratory of historical information sciences. ... Senior laboratory assistant (2) . ...

Еще в разделе: (Показать все результаты (>18) - www.hist.msu.ru/ )

• Library systems
• Editions

179. Century Computer Services Ltd

180. BS Form