... Кадр . ... Переменные языка . ... Проблемы условных операций и принципа однократного присваивания в языке COLAMO . ... В рассматриваемом языке переменные языка Colamo разделяются по "способу хранения" на мемориальные (MEMory) , внутренней памяти (InterMem) , коммутационные (COMmutation) и регистровые (REGister) . ... Когда разрабатывался язык Colamo, на чипах ПЛИСов еще не было собственной (внутренней) памяти, поэтому сначала не был введен тип переменной, соответствующий хранению данных в ней. ...
... Web portal on atmospheric environment is developed by international consortium as a be-lingual information resource in area of atmospheric physics and chemistry and in related domain air quality assessment and management. ... The portal has all typical component and services like collections of links, user group registration, discussion forum, etc. ... Each scientific site is an information-computational system designed in Internet technologies. ... 00189 138. ... 2003 . ... 2002, 252 . ...
TUS/KLYPVE Program for Observation of Extreme Energy Cosmic Rays from Space B.A. Khrenov DV Skobeltsyn Institute of Nuclear Physics of MV Lomonosov Moscow State University Workshop "Cosmic Ray Large Scale Experiments in the Second Decade of the 21st Century" 17 May 2011 TUS/KLYPVE collaboration SINP MSU, JINR (Dubna), RSC "Energia", Consortium "Space Regatta" EWHA University (Seoul, Korea) Puebla University (Mexico) Universities of Japan, RIKEN (Tokyo). ... Digital oscilloscopes for UV flashes. ...
Volume 163, number 2 FEBS 0973 November 1983 Diazepam inhibits cell respiration and induces fragmentation of mitochondrial reticulum Ivan A. Vorobjev and Dmitry B. Zorov A.N. Belozersky Laboratory of Molecular Biology and Bioorganic Chemistry, Moscow State University, 117234 Moscow, USSR Received 1 August 1983; revised version received 14 September 1983 Diazepam (70-150 µg/ml) significantly inhibits oxygen consumption by pig kidney embryo cells and causes the cellular ATP level to fall. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/vorobjev83.pdf -- 1055.8 Кб -- 24.05.2002 Похожие документы
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
... All Authors Title Abstract Index terms Full Text . ... Home > ICONO/LAT 2016 > 2014 International Conference on Laser Applications in Life Sciences > About the Conference > Submissions . ... All URL addresses in the text (e.g., http://pkp.sfu.ca ) are activated and ready to click. ... If submitting to a peer-reviewed track of the conference, authors' names are removed from submission, with "Author" and year used in the bibliography and footnotes, instead of authors' name, paper title, etc. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... The main physical factor influencing sound propagation in the ocean is water motion altering the sound speed and, consequently, the travel time of the acoustic signal. ... This paper describes the method and results of an experimental investigation of acoustic signal travel time fluctuations on a super-long path Hawaii Kamchatka. ... Using the M-sequence allows one to measure travel time fluctuations of acoustic signal propagating along different ray groups [Zverev and Stromkov, 2001]. ... Figure...
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
... Кафедра . ... Визуализация в научных исследованиях . ... Электронные ресурсы, доступные из сети ВМК МГУ . Доступ к электронным текстам научных журналов из сети МГУ . Служба технической поддержки факультета ВМК МГУ . ... Численные методы решения нелинейных уравнений [ PDF 158 КБ ] . ... студентам-геологам . ... Введение в язык C++, линейные алгоритмы, арифметические операторы [ PDF 810 КБ ] (03 сентября 2011 года) . ... 2008?2016 Кафедра АНИ факультета ВМК МГУ имени М. В. Ломоносова . ...
ORF ALEA CENTER FOR GL OB AL INTERNA TIONAL S TUDIES UNIVERSIT Y OF C ALIFORNIA, SANT A BARBAR A THE ROLE OF RELIGION IN GLOBAL CIVIL SOCIETY: THE MOSCOW WORKSHOP Lomonosov Moscow State University Moscow , Russia June 19, 2013 Sponsored by the Henry R. Luce Initiative on Religion and International Affairs Luce Moscow Workshop The Moscow workshop for the Or falea Center 's Luce Project on religion in ... Moscow State University has its own church of the Saint Tatiana. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2013/12/Luce_Moscow_2013_small.pdf -- 1404.9 Кб -- 22.12.2013 Похожие документы
... Laboratory of Medicinal Chemistry was established at the Department of Chemistry, Lomonosov Moscow State University in October 2013. ... We apply modern molecular modeling and chemoinformatics methods as well as develop new approaches. ... We have developed efficient methods for the analysis of quantitative structure-activity relationships and design of novel promising structures based on diverse theoretical approaches. ... Home . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...
Новый сайт Института русского языка и культуры (ЦМО до 2013 года) доступен по адресу www.irlc.msu.ru . About CIE MSU . ... Useful Information . ... For Teachers . ... Vestnik CIE (in Russian) . ... Alumni . About Moscow University . ... Graduates of CIE MSU former Pre-University Department of Moscow State University is a huge friendly family spread worldwide. ... In 2004 when the 50th anniversary CIE MSU was celebrated, many graduates arrived to take part in the anniversary conference. ...
... Geography of World Economy . ... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... About Faculty . ... Research laboratories . ... Field stations . Faculty branches . ... Education . Undergraduate study . ... Type of field courses . ... Russians, that have an education at university level, are allowed to study on government-sponsored places. Foreigners can receive only rental education, they have to conclude a contract with the faculty. ...
Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...
Worldwide Variation in Life-Span Sexual Dimorphism and Sex-Specific Environmental Mortality Rates ANATOLY T. TERIOKHIN, FRANCOIS GUEGAN1 1,2 ELENA V. BUDILOVA,2 FREDERIC THOMAS,1 AND JEAN- Abstract In all human populations mean life span of women generally exceeds that of men, but the extent of this sexual dimorphism varies across different regions of the world. ... We refer to this as life-span sexual dimorphism. ... General Tendency of Life-Span Dimorphism. ... The fragile male. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Dimorph_HumBiol.pdf -- 421.6 Кб -- 16.03.2009 Похожие документы
Security of Quantum Key Distribution Protocol Based on Ququarts Alexander P. SHURUPOV 1 , and Sergei P. KULIK Faculty of Physics, Moscow M.V.Lomonosov State University Abstract. ... In case of D = 4 it was found, that in practice one can relatively easily prepare 12 states based on the polarization states of two-photon field and belonging to three mutually unbiased basis [5,6]. ... This setup allows one to split two orthogonal polarization states of biphoton, namely |H1 and |V2 ones. ...
[
Текст
]
Ссылки http://qi.phys.msu.su/papers/2007-nato-11-123.pdf -- 486.5 Кб -- 13.03.2007
[
Текст
]
Ссылки http://qi.phys.msu.ru/papers/2007-nato-11-123.pdf -- 486.5 Кб -- 13.03.2007 Похожие документы
ft ra D DAYS on DIFFRACTION 2012 1 Theory of selfrefraction effect of intensive fo cused acoustical b eams V.A. Gusev Lomonosov's Moscow State University, Physical Faculty, Department of Acoustics, Russia, 119991, Moscow, Leninskie gori; e-mail: vgusev@bk.ru The theory of selfrefraction of nonlinear acoustical beams is developed based on some exact and approximate analytical equations and solutions. ... What is the main factor limiting the pressure in the focus -- diffraction or selfrefraction? ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gusev_files/diff2012.pdf -- 698.1 Кб -- 07.11.2012
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gusev_files/diff2012.pdf -- 698.1 Кб -- 07.11.2012 Похожие документы