ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Компания HP создает новые возможности для того, чтобы технологии приносили максимальную пользу людям, компаниям, государственным структурам и обществу в целом. ... Бизнес HP в России уже 6 лет подряд показывает результаты лучше рынка ИТ в целом. ... Вакансии компании Hewlett-Packard: . ... Телефон компании HP: +7 (495) 797-35-00. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...
... Поиск по МГУ | Лента новостей | ... Новости . ... Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . Комментарии к новости: Протестующие в Гонконге используют для связи разработанный выпускником мехмата МГУ имени М.В. Ломоносова мессенджер . ... Они перешли на разработанный выпускником мехмата МГУ имени М.В. Ломоносова мобильный мессенджер FireChat, который использует Wi-Fi и Bluetooth. ... 2003 2011 MsuNews.Ru Новости МГУ . ...
On the 3th of November a report of Drozdov Alexander, manager of Intel Corp. in Russia was presented on the seminar "Mathematics of computers, chips, and electronic circuits". ... Cadence Design Systems, Inc. and Intel, Corp. supports this seminar. ... The main purposes of this seminar are the following: . ... The seminar implements scientific and technical contacts for both domestic and foreign experts in the field of design and use of electronic computing systems. ... Seminar organization: . ...
... NUCLEI, PARTICLES, FIELDS, GRAVITATION, AND ASTROPHYSICS Wavelet Analysis of Fine-Scale Structures in the Saturnian B and C Rings Using Data from the Cassini Spacecraft E. B. Postnikova and A. Yu. ... These factors are especially important for the fine-scale structure of Saturn's A ring. ... The efficiency of the wavelet transform with a simple Morlet wavelet basis in solving this task was successfully demonstrated by our study of resonance structures in Saturn's A ring [10]. ...
... OCEAN ACOUSTICS. ... It is proposed to use high frequency resolution methods of sonographic analysis (spectral time representation) of projections of the acoustic power flux vector for spatial resolution of sources that pro vide a higher signal to noise level at the output of the processing system. ... The problem of obtaining an acoustic image is extremely difficult, since the required spatial source resolution at low frequencies is usually several times smaller than the acoustic wavelength. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Научные семинары . ... расписание семинаров . семинар 1 . ... Отчет о семинаре || ... This talk will focus on one of the emerging technology for solar light conversion into electricity; the dye-sensitized solar cell. ... The present lecture will give a general background to the solar energy field with a focus on dye-sensitized solar cells. ... С докладом Dye-sensitized Solar Cells Materials and Interfaces выступил профессор Lars Kloo из Королевского технологического института г. Стокгольма. ...
Monitoring of chloride and chloride-selective ion channels activity using genetically encoded fluorescent sensors. ... Quinoline-based fluorescent dyes sensitive to Cl have low biological toxicity, relatively good sensitivity and selectivity to Cl and rapid response to changes in Cl. ... Thus, development of molecules with sensitivities closer to this physiological range would provide a useful tool for monitoring Cl in biological preparations. ...
Home Search Collections Journals About Contact us My IOPscience On the problem of the spontaneous exchange-driven electron interwell re-population in semiconductor quantum wells This article has been downloaded from IOPscience. ... The wave function for an electron in the second well has a similar form. ... Now our goal is to prove that for any electron state with all electrons in one well one can build another state with electrons equally populating both wells, which is lower in energy. ...
... Инженерия академического текста . Что такое хороший аналитический текст љ(учебное эссе, курсовая работа, диплом или диссертация, статья) ?љ Ясно, что љне результат соблюдения проформы (введение љ - основная часть љ - љ заключение), не монтаж из ?правильных? тезисов , подкрепленных љпримерами , љи не потокљ фактовљ вперемежку сљ личными соображениями .љ ... Учебное пособие для вузов?. М., 2015. ... Пятница, 19 февраля 2016 . 14.4 0 -16.10 . ... Comments (0) . ... Name (required) . ...
Международная культурная и научная конференция по механике для студентов, аспирантов и научных руководителей . ... Стамбул 9-16 мая 2009 г . ICAMES 2009 . ... CULTURAL and ACADEMIC MEETING . of ENGINEERING STUDENTS . ... ICAMES (International Cultural and Academic Meeting of Engineering Students) is an international, academic, scientific and cultural project competition that is held in May annually by the Engineering Society (ENSO) of Bogazici University. ... ICAMES 2009 (9 - 16 May 2009) . ...
LIB-DVM library. Preliminary design . ... Lib-DVM is Run-Time System for DVM-programs execution. A parallel Fortran DVM (or C-DVM) program is translated to the program in the standard Fortran 77 (or C) language extended by Lib-DVM function calls, and to be executed according to SPMD model on the each processor program is assigned to the task. ... Input of the parameters, controlling the operating of Run-Time System, DVM debugger and the accumulation subsystem of the execution characteristics. ...
Accommodation Several hotels can be found near the MSU: Hotel Universitetskaya http ://www. hotel -universitet.ru/ Lomonosov hotel http ://www.hotellomonosov.ru/en/index.html Hotel Sputnik 3* http ://www.hotelsputnik.ru/ Hotel Salut 3* http ://www.hotelsalut.ru/ Hotel Astrus Moscow city hotel http ://www.astrus.ru/ Contacts E-mail info@radiochemistry-msu.ru Web-page radiochemistry-msu.ru/ ... School activities will include both theoretical and practical courses. ...
[
Текст
]
Ссылки http://www.chem.msu.ru/rus/events/2014-04-Spring.school.radiochemical.analysis.pdf -- 435.3 Кб -- 26.02.2014 Похожие документы
... E-mail: Tchytannya@gmail.com Website of the Conference: www.tchytannya.org.ua Mailing address: National University "Law Academy of Ukraine named after Yaroslav Mudriy", Department of the Constitutional Law of Ukraine, organizing committee of The International Science Conference of Young Scientists, Researchers, Postgraduates and Students "Values of modern constitutionalism (V Todyka's readings)" Pushkinska street, 77, Kharkiv, 61024, Ukraine. ...
[
Текст
]
Ссылки http://www.law.msu.ru/bitcache/9af64c1c38133e2400976ad6af22fd1007e46b3e?vid=21924&disposition=attachment&op=download -- 283.0 Кб -- 01.10.2012 Похожие документы
PALAEOPATHOLOGY IN RUSSIA: HISTORICAL BACKGROUND A. Buzhilova Institute and Museum of Anthropology, MSU, Moscow В статье предлагается версия хронологических этапов становления палеопатологии в России. Особое внимание уделяется первым работам в области палеопатологии, представленным основателями физической антропологии в России - К.М. Бэром и Д.Н. Анучиным. Рассматривается вклад основателя русской школы палеопатологии Д.Г. Рохлина. ... Бужилова А.П. Homo sapiens: история болезни. ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/091/3.pdf -- 179.0 Кб -- 19.08.2010
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/091/3.pdf -- 179.0 Кб -- 19.08.2010 Похожие документы
February 11, 1997 Neurokinetics Case Study Background 2 The Bionic Glove 2 Details 2 Development 3 Commercialization 4 The Issues 4 Intellectual Property 4 The Market 5 Distribution 7 Clinical Trials 7 Product Development 9 Regulatory Considerations 10 Sales Projections 11 Financing 12 Commercial ... Research indicated that the target market for Canada and the United States combined was approximately 76,850 existing patients with 2,850 new patients anticipated each year. ... patients | ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/neurokineticscasestudy.doc -- 189.0 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/neurokineticscasestudy.doc -- 189.0 Кб -- 27.10.2005 Похожие документы
... On-line консультант . ... Приглашаем всех, интересующихся исследованиями и разработками в области компьютерных сетей, принять участие в семинаре по software-defined networking, который состоится 4 июля 2011 (понедельник) в 19.30 в Политехническом музее (Новая площадь, д 34;, подъезд 9, малая аудитория). ... We are about to witness a revolution in the networking towards so-called "Software Defined Networking" (SDN). SDN enables innovation in all kinds of networks . ... Copyright ВМиК МГУ , 2008 . ...
... Seminar archive . ... Type Ia Supernovae (SNe Ia) have an important role to measure a distance to an anonymous galaxy because they have a good correlation of the decline rates of the light curves with the absolute luminosity. ... First, super-Chandrasekhar SNe which have extremely high luminosity, slow decline rate of the light curves, slow expansion velocity and strong carbon features. ... As another example of diversity of SNe Ia, I would like also to introduce Type Iax SNe. ... All seminars: . ...
Curriculum Vitae . ... Degree: candidate of science in mathematics and physics (PhD), obtained from Lomonosov Moscow State University (2006) . ... 2003 - 2006 . Lomonosov Moscow State University , Faculty of Computational Mathematics and Cybernetics . ... Lomonosov Moscow State University , Faculty of Physics . ... Kurchatov student scholarship at Lomonosov Moscow State University . ... Young Scientists Summer Program at International Institute for Applied System Analysis ( Laxenburg , Austria ) . ...