... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...
... Главная Факультет политологии Новости факультета Новость . ... С 1 по 3 апреля 2014 года с успехом прошла третья ежегодная межфакультетская студенческая научно-практическая конференция на английском языке ?Актуальные проблемы политологии и философии на современном этапе?. В конференции приняли участие 60 студентов: 48 студентов 1, 2 и 3 курсов факультета политологии и 12 студентов 1 и 2 курсов философского факультета. ... Политология России . ... Поступление на факультет политологии в 2016 году . ...
... Destructive effects of many tsunamis are confined to areas within about one hour of the initial propagation time (that is, within a few hundred km of their source). ... Two international tsunami workshops have recently been held in Russia ( "Tsunami Mitigation and Risk Assessment," Petropavlovsk-Kamchatskiy,1996 , and "Tsunami Risk Assessment Beyond 2000: Theory, Practice and Plans," Moscow, 2000). ... The final product of the workshop will be recommendations on local tsunami warning and mitigation....
... Awards and Prizes . ... Home Research Awards and Prizes . Scholarships of Lomonosov Moscow State University for PhD students and young scientists: . Alexey L. Voskov . ... Awards ofљXIX International Conference on Chemical Thermodynamics in Russia RCCT?2013 (5 of 16): . ... Ilya Pentin, Alexey Voskov (2005) . ... Awards of Moscow government in 2005: . ... Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...
... GOES corrected results are wrong, because the publication Smart D.F. and M.A. Shea, Comment on the use of GOES solar proton data and spectra in solar dose calculations, Radiation Measurements 30 (1999) 327-335 was erroneous (see "The issues...." above. ... The criticism of the use of the log-normal distribution for the data fit in Feynman et al. is excessive. Indeed, Feynman et al. use only the high intensity part for the fit making the results almost independent of the low energy part. ...
... On-line консультант . ... Основная формула интегрального исчисления. ... Взаимное расположение прямой и плоскости, основные задачи на прямую и плоскость. ... Основные понятия машинной графики. ... М.: Наука, 1979,МГУ 19985 . ... Дейт К. Введение в системы баз данных. ... Операционные системы, их основные функции. ... Основные понятия реляционной модели данных. ... Основные функции СУБД. ... Основные понятия и определения, относящиеся к информационной безопасности. ... М., ВМК, 2003г. Поиск по сайту ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Страна восходящего солнца подарила людям мир anime - мир японских мультфильмов, живущей своей, особой жизнью. ... В свое время телеканал 2(2 показал отличные мультсериалы (Роботек, Грендайзер, СейлорМун), чем заметно пополнил ряды любителей японской анимации. ... На основе наиболее популярных мультфильмов - Gundam, Macross (его американская версия Robotech хорошо известна в России), Slayers, Ghost in Shell - создаются консольные игры всех жанров, от аркадных файтингов и симуляторов до стратегий и РПГ. ...
... An implementation of this method known as the generalized marching algorithm is described in detail in [1] . ... Molar mass . ... Массовый момент . ... This subroutine performs row and column scalings to equilibrate (to balance) a real general matrix . Масштабирование матриц . ... Mass matrix . ... This set has fewer elements than $K$ has . ... Метод . The method for solving the problems in mechanics . ... Метод моментов . ... Модули диаграммы секущий и касательный . ... Concrete modulus . ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
... STATISTICAL, NONLINEAR, AND SOFT MATTER PHYSICS Oscillatory Traveling Waves in Excitable Media E. P. Zemskova and A. Yu. ... Reactiondiffusion systems with diagonal and cross diffusion are examined. ... TRAVELING WAVES WITH OSCILLATORY PROFILE In this section, we consider one-dimensional twocomponent reactiondiffusion systems described by 344 OSCILLATORY TRAVELING WAVES IN EXCITABLE MEDIA 345 extended FitzHughNagumo models with diffusing activator and inhibitor. ... Diagonal diffusion. ...
[
Текст
]
Ссылки http://chaos.phys.msu.ru/loskutov/PDF/Zemskov-Loskutov_English.pdf -- 266.6 Кб -- 05.02.2009 Похожие документы
... Студенты, аспиранты и докторанты кафедры занимаются по индивидуальным планам. ... Имеется большой выбор специальных курсов для студентов и аспирантов. Студенты 3-го курса проходят физико-механический практикум в филиале кафедры - Центральном Научно-исследовательском институте специального машиностроения. Каждый студент 3-го курса (а желающие и со 2-го курса) имеет собственного научного руководителя и работает в одном из специальных семинаров кафедры, пользуется советом куратора. ...
Информационное письмо БФ-01 (23.01.96) О начале финанстрования РФФИ и начале реализации проекта БАФИЗ-96 (РФФИ номер 95-07-19502). ... В связи с этим, 16 января 1996 года мы провели совещание с частью основных исполнителей из институтов-участников проекта БАФИЗ-96. Приглашения по e-mail были направлены во все семь институтов- участников проекта: ОИЯИ, НИИЯФ МГУ, ИФВЭ, ИТЭФ, ИЯИ, ПИЯФ, ИЯФ СОРАН. ... 8) Хранение и обеспечение эффективного поиска в полнотекстовых и гипертекстовых базах данных. ...
Here is the new version of catalog originally created and developed by S. Melgunov. Site is discontinually updating by professional biologists and students of biology faculty of MSU. ... Your status is user . ... The purposes of JCatalog: . ... Here is the science journal catalog named JCatalog . ... JCatalog provide fast access to on-line content of journal on different mirrors, such as blackwell-synergy , sciencedirect Х e-library . ... All journals . 1747 all , 138 free, 756 full-text ] . ...
... Alexander A. Moskovsky . ... Software Designer : . ... Projects: . Janitor II, Custodian III for Matrix Logic - utilities for DOCS Open EDMS (electronic document management system), C++/Win32 platform. ~2 man-year project with 5 persons team. iBuzz - (for ibuzz.com ) large client-server system (Win32, Enterprize Java Beans, Oracle, Sun/Solaris). ... Lunch Ordering Web System. ... Software Resources International , former Digital Moscow Software Center, . ... Physical Chemistry chair, . ...
... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...
... 1997-2000 ) - (0-117) , .. 2001 . ... a. ppa . ... a (a paa), pa . ... 1999 "" - . ... 1 31 1997 , , 1 1998 , . ... p a pa a apa pa; ! ... a, ap aa a a ppa paa apa a p p p p a paa P. - . ... 5 2000/2001 317 9.00-10.35 12.40-14.15 .. ... p pp apap p p pa. 2. paa ppa ppa · Ppa ppa ap pa a p pap. · paa pa ppa pa ap ppa paa paa pap. · pp pa ppa AREN (pa pp a, R-apa, p p apa). · a pa a pa p p (a pa ppa, ). ... 100 80 60 40 20 0 1997 1998 1999 2000 38 100 80 60 40 20 0 1997 1998 1999 2000 , 250 , . ...
WEB- . ... 495) 939 5560. 1 30 . ... 2) : A. IGAMBERDIEV ( ). Igamberdiev AU (2012) Physics and Logic of Life. ... BioSystems 109: 336-345, Igamberdiev AU (2008) Objective patterns in the evolving network of non-equivalent observers. BioSystems 92: 122-131, Igamberdiev AU (2007) Physical limits of computation and emergence of life. ... BioSystems 77: 47-56.) ... 1 - : DLF- TSK- ». DLF- [Le-11] D, L, F. D (http://math.bu.edu/people/levit/mem-segal.pdf), L " ", F " ". ... DLF - . ...