Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>13) - halgebra.math.msu.su/ )

• staff:guterman:conf_rus.html | Кафедра высшей алгебры

. Summary of experimental results . The light absorbing capacity of phytoplankton, estimated from Fo , and its photosynthetic activity (estimated as Fv/Fm ) are key characteristics of the primary processes of photosynthesis. We suggested a formula for calculation of the primary production of phytoplankton from these two characteristics and underwater irradiance. The probing data were used to plot vertical profiles of phytoplankton productivity in various regions of the Baltic, Norwegian, and South China

Еще в разделе: (Показать все результаты (>12) - www.biophys.msu.ru/ )

• Сектор информатики и биофизики сложных систем

The idea of the conference was conceived with active participation of Prof. A.S. Mishchenko. ... K-theory of C*-algebras, . index theory, . algebras of pseudodifferential operators on singular manifolds, . ... A. Kordyukov, T. Krainer, J. Kubarski, U. Ludwig, G. Lysik, V. M. Manuilov, C.I. Martin, S. T. Melo, A. S. Mishchenko, B. Monthubert, G. Morsella, I. M. Nikonov, C. A. Pantea, A. Pavlov, C. Pintea, A. Pavlov, T. Yu. ... The participation cost is 220 euros. ...

Еще в разделе: (Показать все результаты (>179) - higeom.math.msu.su/ )

• english

Intel, .. ... Virtual Machines - Versatile Platforms for Systems and Processes. ... 2006. ... Intel® 64 and IA-32 Architectures Software Developer's Manual Volume 1: Basic Architecture. ... Pin -- a dynamic binary instrumentation tool. http://www.pintool.org/. ... Using Simics for virtualized systems development.-- 2007.http://www.virtutech.com/whitepapers 6. ... The 16th IEEE International Symposium on High-Performance Computer Architecture (HPCA). 2010.- ...

Еще в разделе: (Показать все результаты (>2) - master.cmc.msu.ru/ )

• http://master.cmc.msu.ru/files/Software_Protection.pdf

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>5) - www.eng.geogr.msu.ru/ )

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>26) - observ.pereplet.ru/ )

Mechmath admission for internetional students . Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mathematics and Mechanics Faculty was created 1 May 1933 with a recovery of the faculty system inљ Lomonosov MSU . ... The faculty prepares high level experts of wide areas of Mathematics, Mechanics and Applying Mathematics , possessing theoretical knowledge and a technique of scientific experiment . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>6) - pk.math.msu.ru/ )

• Mechmath admission for internetional students

... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>20) - mouse.belozersky.msu.ru/ )

• Example of alignment
• Alignment example
• NPG-explorer

... Science Park . ... Agency for networking, information and communication technologies ( NETINFOKOM LLC) ank-nic@rambler.ru http://www.msunews.ru/ . ... Developing the infrastructure and information support needed for projects that provide an interdisciplinary exchange of science information and the potential for collective work on the base of network services and technologies. ... The company has a great deal of experience in the design, development and penetration of laboratory information systems. ...

Еще в разделе: (Показать все результаты (>8) - www.sciencepark.ru/ )

... Научный календарь МГУ Научная жизнь на ФГУ Конференции Научные семинары Международная конференция ФГУ International Conference Молодым ученым Электронные ресурсы Список полнотекстовых баз данных (журналы) Список полнотекстовых баз данных (книги) Список реферативных баз данных Материалы международных конференций Архив мероприятий Конференции Научные семинары Круглые столы Презентации Международная конференция ФГУ Фестиваль науки Международное сотрудничество . ... Agricultural and Biological Sciences ...

Еще в разделе: (Показать все результаты (>54) - www.spa.msu.ru/ )

... Department of Mathematics, . Faculty of Physics, MSU . ... Differential equations . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . Numerical methods in physics . ... Abstract differential equations with applications in mathematical physics . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Methods of finite differences in mathematical physics . ... April 13, 2016. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>9) - math.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes
• ConClus
• Nhunt: program for nucleic acid sequence similarity search

... The department was founded in late sixties by Prof. D.Ya.Martynov, who for many years was also the director of Sternberg Astronomical Institute. At present time, the head of the department is Prof. A.M.Cherepashchuk, a pupil of D.Ya.Martynov and his successor as the director of SAI. Since Prof. Martynov, the scientific activity of the department was primarily related to binary stars. ... The department consists of 15 members most of which have Ph.D. in Astrophysics. ...

Еще в разделе: (Показать все результаты (>18) - uranus.sai.msu.ru/ )

• Elena Seifina

Summary Progress Report 2010 ­ 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...

Еще в разделе: (Показать все результаты (>113) - fgp.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf

... 2015 . ... The article analyzes the existing methods of investment climate evaluation. The author also proposes a new method, the factorial estimation of investment climate, developed by the author on the basis of the analysis of investment appeal, investment activity and efficiency of investment activity. ... Investments, evaluation method, investment climate, investment activity, investment appeal, efficiency of investment activity . ... Public Administrarion". ... Copyright ї 2015 SPA MSU . ...

Еще в разделе: (Показать все результаты (>311) - ee-journal.spa.msu.ru/ )

... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...

Еще в разделе: (Показать все результаты (>142) - bioinf.fbb.msu.ru/ )

• RNA Kinetics: Theory
• User's guide
• SDPsite - Gallery of examples

TB, SH, US, JPhysG/276799, 10/07/2008 IOP PUBLISHING J. Phys. G: Nucl. ... The ring-like and jet-like structures in two-dimensional angular histograms are well extracted by wavelet analysis both for toy models and in Monte Carlo simulated events of nucleus­nucleus collisions at LHC energies. ... We answer these questions by showing that the method of the wavelet analysis allows us to distinguish jets from rings and to find jet positions among the underlying backgrounds in Monte Carlo simulated events. ...

Еще в разделе: (Показать все результаты (>54) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~igor/seminar/Porteboeuf-Houssais_AFTER_Mai2012_AMPT.pdf
• http://lav01.sinp.msu.ru/~vlk/report97_monet.ps
• http://lav01.sinp.msu.ru/~vlk/pbarp_mypreprint.ps

Preconcentration Laboratory . Laboratory of Chromatography . ... Laboratory of Kinetics Methods of Anaysis . ... Sorption-spectroscopy methods for determination of organic . ... Room-temperature ionic liquds, computational chemistry . ... New detection methods in ion and ion-pair chromatography . ... For that purpose, methods of selective preconcentration are developed along with the methods of determination of analytes directly in the sensing film or in the permeate after membrane diffusion. ...

Еще в разделе: (Показать все результаты (>43) - analyt.chem.msu.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>12) - iconolat13.phys.msu.ru/ )

• Program topics

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>93) - www.msm.biophys.msu.ru/ )