Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>9) - mph.cmc.msu.ru/ )

Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for

Еще в разделе: (Показать все результаты (>2) - bc.fdo.msu.ru/ )

Regular Maps and Their Groups H. R. Brahana American Journal of Mathematics, Vol. ... In the one case the number of regions of the map is equal to twice the order of the group and in the other the number of regions is equal to the, order of the group divided by the number of sides of a region. ... The Group of a Regular Map. ... Noting that there exists no group of order 40 and degree 8, we have the result that there exists no regular map of ten 4-sided regions on - a surface of genus two. ...

Еще в разделе: (Показать все результаты (>39) - dfgm.math.msu.su/ )

• http://dfgm.math.msu.su/files/0articles/Ilyutko/0904.2862v1.pdf
• http://dfgm.math.msu.su/files/ivanov-tuzhilin/Lecture_Notes.pdf
• http://dfgm.math.msu.su/files/0articles/Ilyutko/ilyutko-JKTR.pdf

CLINICAL MICROBIOLOGY REVIEWS, July 2004, p. 581­611 0893-8512/04/$08.00 0 DOI: 10.1128/CMR.17.3.581­611.2004 Copyright © 2004, American Society for Microbiology. All Rights Reserved. Vol. 17, No. 3 Phase and Antigenic Variation in Bacteria Department of Microbiology, School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104-60761 and Department of Medical Microbiology and Immunology, College of Medicine, Texas A & M University System Health Science Center, College Station, Texas

Еще в разделе: (Показать все результаты (>4) - dis.bio.msu.ru/ )

• http://dis.bio.msu.ru/States/Milko_Kreier_2007_en.pdf

... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>7) - pk.math.msu.ru/ )

• IX Festival of Science | Mechmath admission for internetional students

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

... Science . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Home Science and education Scientific Laboratories Laboratory of nonlinear polarization optics . ... The mechanisms of evolution of polarization during radiation propagation in nonlinear media with nonlocality of optical response. ... As a result, a new field of science has originated, the nonlinear polarization optics, providing new insights into the interplay of polarization effects in classic nonlinear optical processes. ...

Еще в разделе: (Показать все результаты (>50) - ilc.phys.msu.ru/ )

• Публикация
• ILC MSU
• Grant detail

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>2) - ocl.sai.msu.ru/ )

... On-line консультант . ... Приглашаем всех, интересующихся исследованиями и разработками в области компьютерных сетей, принять участие в семинаре по software-defined networking, который состоится 4 июля 2011 (понедельник) в 19.30 в Политехническом музее (Новая площадь, д 34;, подъезд 9, малая аудитория). ... We are about to witness a revolution in the networking towards so-called "Software Defined Networking" (SDN). SDN enables innovation in all kinds of networks . ... Copyright ВМиК МГУ , 2008 . ...

Еще в разделе: (Показать все результаты (>4) - erp.cmc.msu.ru/ )

МГУ имени М.В.Ломоносова Русская версия . ... Отправить сообщение Посмотреть контакты . Delete from contacts . Add to сontacts . ... Московский государственный университет имени М.В.Ломоносова, Москва, Россия . ... Филиал МГУ имени М.В.Ломоносова в г. Севастополе, Севастополь, Россия . ... Московский государственный университет имени М.В.Ломоносова, Географический факультет, Москва, Россия . ... МГУ имени М.В. Ломоносова . ... 119991, г.Москва, Ленинские горы, д.1, Главное здание МГУ . ...

Еще в разделе: (Показать все результаты (>10654) - conf.msu.ru/ )

УЧЕБНОЕ ПОСОБИЕ ПО АНГЛИЙСКОМУ ЯЗЫКУ ДЛЯ СТУДЕНТОВ-ГЕОЛОГОВ 1 КУРСА ЧАСТЬ 1 Н.Г.КИТКОВА, Т.Ю.САФЬЯННИКОВА Рецензенты: Д.г.-м.н., профессор МГУ имени М.В.Ломоносова Н.В.Короновский К.ф.н., заведующая кафедрой иностранных языков РГГУ нефти и газа имени Губкина Е.Ю.Симакова Содержание Introductory Section A scientist Studies Science Section I. Meet the Sciences Unit I: What is Science? Unit II: Geology as a Science Unit III: Branches of Geology Unit IV: The Importance of being a Geologist Unit V: Revision

Еще в разделе: (Показать все результаты (>2) - geol.msu.ru/ )

• http://www.geol.msu.ru/obsh/uch_ch2.doc

Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS WxtЊ vҐЂЂxtzтxс4 g{x YtvтЂрч Ґy TЊрс уxЊx tvvx¶рxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...

177. ARCTIC BIRDS SPECIES DATABASE INTRODUCTION

178. A. Kh. Pergament - Computational Mechanics Department

179. http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%202.pdf

180. http://oc.cs.msu.su/smirnov/PPP/beameruserguide.pdf