... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...

Еще в разделе: (Показать все результаты (>11) - en.fbb.msu.ru/ )

• BackgroundтАФ Faculty of Bioengineering and Bioinformatics, MSU

Еще в разделе: (Показать все результаты (>8) - mguteam.chat.ru/ )

• About Work Outs on Our Team

... Глобальные модели . ... глобальное . ... JGR, 82, 239-255 . ... cф.гарм. до 3-го пор.=60њ ячейка . ... cф.гарм. до 7-го пор. ... JGR, 89, 5953-5986 . ... JGR, 99, 6945-6980 . ... JGR, 98, 9793-9823 . ... 1995) . JGR, 100, 24037-24059 . ... JGR, 101, 27791-27810 . ... Van der Hilst et al. ... JGR, 103, 30055-30078 . ... JGR, 1995, 6829-6852 . ... Van der Hilst (1995) . ... Widiyantoro and Van der Hilst (1996) . ... Widiyantoro and Van der Hilst (1997) . ... Van der Voo et al. ...

Еще в разделе: (Показать все результаты (>16) - sbmg.geol.msu.ru/ )

• Ссылки на сейсмотомографические сайты
• Форма 502
• Ф-502

... Master . Master net Homepage . ... MASTER-Amur . ... Amb: . Dust: . ... Direct . 23s . ... 45s . ... observed area: . best limit: . Cameras . ... MASTER-Tunka . ... MASTER-Ural . master.kourovka.ru . ... MASTER-Kislovodsk . ... MASTER-Crimea . ... MASTER-SAAO . ... MASTER-IAC . ... MASTER-Argentina . master.sai.msu.ru:8080 . master.sai.msu.ru . ...

Еще в разделе: (Показать все результаты (>197) - master.sai.msu.ru/ )

• SAI Space Monitoring Laboratory

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• StructAlign help

... ECOLOGICAL COOPERATION" . ... Brjanskaja oblast, Dubrovskij rajon, Seshcha (village), School . Brjanskaja oblast, Djat'kovskij rajon, Bytosh (village), School . ... Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Borodino (village), School . Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Yardenikha (village), School . ... Moscow, Children's Ecological Center of the National Park "Losinyj Ostrov" - the coordinator of ecological work of 18 Korolev-town's schools . Moscow, School #222 . ...

Еще в разделе: (Показать все результаты (>218) - www.ecocoop.ru/ )

• The Ecological Cooperation project is the first large scale childrenтАЩs

... research | ... Matvey Viktorovich Youdov . ... Organic Chemistry Division, Chemistry Department, Lomonosov Moscow State University, Leninskie Gory, 199899 Moscow, Russia. ... B.S./M.S. in Chemistry "Study of structure of humic substances and their hydrolysis products by 1H and 13C nuclear magnetic resonance spectroscopy techniques" Employment: . ... Current research activity is dealing with investigation of structure of hydrolyses products of humic substances by methods of NMR spectroscopy. | ...

Еще в разделе: (Показать все результаты (>4) - www.mgumus.chem.msu.ru/ )

• MGUMUS -- Ekaterina A. Ilyukhina

Tentative academic program of Summer School in Coastal Ecology and Biological Safety (June 14-26, 2010; White Sea Biological Station) Version of January 27, 2010 Module I (4 days ): Invertebrates' Diversity of Coastal Zone Lectures + seminars, boat and short hiking excursions, laboratory work , individual work a) Main groups of invertebrates: the resident and endemic species of the W hite Sea b) Gathering and ...

Еще в разделе: (Показать все результаты (>9) - www.bio.msu.ru/ )

• The Second White Sea Molecular Zoology Summer School ? Биологический факультет

... Home Our Team Staff Lora S. Nikolaeva . ... Kalinin, USSR; graduated from Lomonosov Moscow State University, Mechanics and Mathematics Department in 1961. Work at Lomonosov Moscow State University, Chemistry Department from 1967. ... Joint investigstions with Department of Chemistry of Tver State University and Biology Department of Lomonosov Moscow State University have been made. ... Colloquium on 24.12.12 20 Dec 2012 . ... Department of Chemistry . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• PhDi Laboratory of Chemical Thermodynamics
• Valery P. Vassiliev Laboratory of Chemical Thermodynamics
• Carbamide Laboratory of Chemical Thermodynamics

... 4, 1997 LETTERS TO THE EDITOR HETEROCYCLES WITH A BRIDGE NITROGEN ATOM. ... NOVEL SYNTHESIS OF THE OXAZOLO[3,2-a]PYRIDINIUM CATION BY RECYCLIZATION OF A MESOIONIC PRECURSOR: CONFIRMATION OF A COMPUTER PREDICTION E. V. Babaev and I. A. Oriova Mesoionic heterocycles as a rule are unstable. ... Thus on boiling in water, 2-oxo-3-acyloxazolo[3,2-a]pyridines are c6nverted to N-(~-oxoalkyl)-2-pyridones. ... We found that when water is added to a solution of 2-oxo-3-benzoyloxazolo[3,2-a]pyridine (I) in cone...

Еще в разделе: (Показать все результаты (>159) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/042e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/032e.pdf
• CURRICULUM VITAE

Space Weather . ... Analysis . ... Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. ... Irina Myagkova, PhD, senior researcher - scientific analysis and modeling . ... Sergey Dolenko, PhD, senior researcher - adaptive methods of data prediction and analysis . ... Wera Barinova, junior researcher, senior programmer - programming . ...

Еще в разделе: (Показать все результаты (>4) - swx.sinp.msu.ru/ )

• SWX - Главная

МГУ имени М.В.Ломоносова Русская версия . ... Geography . ... 29 Feb 2016 . ... Head of Department of Economic and Social Geography of Russia, Chair of Commitee of Scientific and Research work, Doctor of Geography. ... Prof. Alexandr Gennadiev - Deputy Head of Department of Landscape Geochemistry and Soil Geography, Doctor of Geography. Prof. Kirill Dyakonov - Head of Department of Physical Geography and Landscape Science, Corresponding Member of Russian Academy of Sciences, Doctor of Geography. ...

Еще в разделе: (Показать все результаты (>33) - conf.msu.ru/ )