... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...

Еще в разделе: (Показать все результаты (>8) - lab106.imec.msu.ru/ )

. Information by your request is not available. This is ejudge contest administration system, version 3.5.1+ (GIT 2eb5ef0), compiled 2016-03-20 11:30:56. This program is copyright 2000-2016 Alexander Chernov. This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation ; either version 2 of the License, or (at your option) any later version. Visual design and web-interface 2006-2016 Toto Lasvik .

Еще в разделе: (Показать все результаты (>7) - acm.msu.ru/ )

... Лейкин Ю.А., Соловьев В.К. Мейчик Н.Р. 1978 . ... Мейчик Н.Р., Лейкин Ю.А. 1983 . ... Мейчик Н.Р., Лейкин Ю.А. 1985 . ... Мейчик Н.Р., Лейкин Ю.А., Колосова И.Ф, Тарасова Т.И. 1986 . ... Мейчик Н.Р., Лейкин Ю.А., Галицкая Н.Б., Антипов М.А., Горячева Н.В., Клименко И.А, Медведев С.А. 1987. ... Мейчик Н.Р., Лейкин Ю.А., Косаева А.Е., Галицкая Н.Б. 1989 . ... Мейчик Н.Р., Лейкин Ю.А. 1989 . ... Мейчик Н.Р., Лейкин Ю.А., Гейнрих И.А. 1989 . ... Н.Р. Мейчик, И.П. Ермаков, М.В. Савватеева. ...

Еще в разделе: (Показать все результаты (>12) - plantphys.bio.msu.ru/ )

• Камнев Александр Николаевич
• Баштанова Ульяна Борисовна

Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>13) - lmmqsp.sinp.msu.ru/ )

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>3) - saistud.sai.msu.ru/ )

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>57) - mph.cmc.msu.ru/ )

Автор: Юрий Тукачев . ... Официальные русскоязычные руководства пользователя по IBM SPSS Statistics 20 (в формате PDF): . Руководство пользователя по базовой системе IBM SPSS Statistics 20 . Руководство пользователя по функционалу базового модуля IBM SPSS Statistics Base 20 . ... Руководства пользователя на русском языке по IBM SPSS Statistics 20 . ... Флогистон / психологический блог / Руководства пользователя на русском языке по IBM SPSS Statistics 20 . ... 2 Константин Ефимов . ...

Еще в разделе: (Показать все результаты (>251) - www.flogiston.ru/ )

• факторный анализ

... Abstract We are interested in solving real-world planning problems and, to that end, argue for the use of domain knowledge in planning. ... We describe some real-world planning problems that have been addressed by current KB planners. ... HTN planning methods are better suited than disjunctive planners for such problems because HTN systems can interact with humans effectively, use more expressive representations, and can make use of domain knowledge to scale up to complex problems. ...

Еще в разделе: (Показать все результаты (>104) - sp.cs.msu.ru/ )

• http://sp.cs.msu.ru/datalog/levshin-swps.pdf
• Lib-DVM. Detailed design
• DVM-system. Installation guide. Version 3.95

... Language English (en) Русский (ru) . Skip available courses . Управляющий: Алла Леонидовна Назаренко . ... Students will utilize Moodle, an online course management system, as they work to complete the project.љ ... The chief purpose of this courseљљ is to provide you with theoretical insights, practical skills, and ethical standards of the discipline of management with a focus on information management and human resources.љ ... Учитель: Оксана Малютина . ... English Language Courses . ...

Еще в разделе: (Показать все результаты (>10563) - moodle.ffl.msu.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>7) - iconolat13.phys.msu.ru/ )

• Proceedings

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>19) - comphep.sinp.msu.ru/ )

February 11, 1997 Neurokinetics Case Study Background 2 The Bionic Glove 2 Details 2 Development 3 Commercialization 4 The Issues 4 Intellectual Property 4 The Market 5 Distribution 7 Clinical Trials 7 Product Development 9 Regulatory Considerations 10 Sales Projections 11 Financing 12 Commercial ... Research indicated that the target market for Canada and the United States combined was approximately 76,850 existing patients with 2,850 new patients anticipated each year. ... patients | ...

Еще в разделе: (Показать все результаты (>18) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/neuromotioncasestudy.doc
• Start-Up Company Development :: Управление инновационной политики и организации

... The one--time states of different systems are ever compatible. ... ONE -TIME COHERENT INFORMATION The first approach to information characterization of a two-side quantum channel was a formal quantumgeneralization I = S[JA] + S[,B] -- S[,AB] (4) of the classical Shannon mutual information I = SA + SB -- SAB, if a joint density matrix fiAB is given and treated as a strict analogue of classical joint probability distribution PAB ·18 Evidently, to apply this formula to quantum systems ...

Еще в разделе: (Показать все результаты (>70) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/people/zhdanov/teaching/seminar-1-2-Introduction-to-Mathematica.pdf
• http://qilab.phys.msu.ru/papers/JCTE-2002-en.pdf
• http://qilab.phys.msu.ru/papers/LasPhys10_03GrishaninLO.pdf

... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...

Еще в разделе: (Показать все результаты (>2) - www.hsib.msu.ru/ )

... 60° , /2 , / , / , / , / 2 2 2 482 152 0,03 16 1,4 634 0,07 , / 0,05 157 174 0,64 37 3,4 331 0,52 0,10 97 182 0,75 44 4,1 279 0,59 0,15 70 186 0,79 47 4,4 256 0,63 3 0,20 54 188 0,82 49 4,5 242 0,65 0,25 44 190 0,83 50 4,6 234 0,66 5 0,1 /3. ... 1961. ... Rockel B., Raschke E., Weyres B. A parameterization of broad band radiative transfer properties of water, ice and mixed clouds // Beitr. ... Slingo A. A GCM parameterization for the shortwave radiative properties of water clouds // J. Atmos. Sci. ...

Еще в разделе: (Показать все результаты (>2) - atm563.phys.msu.ru/ )

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: €аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>61) - ecfs.msu.ru/ )

• Resources | ECFS
• Topic 2: Barriers to Sustainable Soil Management in Eurasia / Барьеры на пути к
• Online Consultation on Network and Partnerships in the area of Food Security |

... Д. и. еДкдЦЦЗ еУТНУ,ТНЛИ ,Л^ЛУММњИ ЛМТЪЛЪЫЪ ЗЗЦСЦзаЦ 96 ї е НВВ, Д.и., 1998 , , . ... лйкйлйЗлдав йЕкДбйЗДнЦгъзхв ЬмкзДг, <9, 1998 , . ... 1. еДкдЦЦЗ Д.и. й СазДеадЦ дДньфЦЙйль нЦгД а зЦдйнйкхп дмкъЦбзхп лЗйвлнЗДп ЗкДфДыфЦЙйль ЗйгудД 97 млнйвуаЗйлнъ лнДсайзДкзйЙй ЗкДфЦзаь ЗйдкмЙ ЗЦкнадДга .. ... 3) Q. , еДкдЦЦЗ Д.и. й СазДеадЦ дДньфЦЙйль нЦгД а зЦдйнйкхп дмкъЦбзхп лЗйвлнЗДп ЗкДфДыфЦЙйль ЗйгудД 99 Q + ij , j = 1, 2, j , j = 1, 2: Q ( - 1 ) 1 = ------------------------------- , 2D 2 2 2 1 , 2 . ...

Еще в разделе: (Показать все результаты (>157) - www.pereplet.ru/ )

• Super Ratio
• The Avalon Project : Treaty concerning the Cession of the Russian Possessions

... 7.1] Lectures of prof. Scrucca in Advanced quantum field theory (e.g., for the first study of the worldline formalism): http://itp.epfl.ch/webdav/site/itp/users/181759/public/aqft.pdf . ... I. Topological quantum effects Lecture 1 (Spring 2015) , The Outline Before Casimir: the van der Waals forces (presentation, pdf) . ... Lecture 5 (Fall 2015) , Lattice field theory: 'free fields' (presentation, pdf) . Lectures 6-7 (Fall 2015) , Lattice field theory: 'interacting fields'. ...

Еще в разделе: (Показать все результаты (>7) - theorphys.phys.msu.ru/ )

... X-ray data of GX 3+1 (4U 1744-26) obtained in broad energy ranges using BeppoSAX (0.1­200 keV) and Rossi X-Ray Timing Explorer (RXTE) (3­200 keV) offer a unique The Astrophysical Journal, 747:99 (15pp), 2012 March 10 Seifina & Titarchuk possibility to further investigate, in detail, the evolution of X-ray spectral properties during transition events. ... In Figure 2, we illustrate our spectral model as a basic model for fitting the BeppoSAX and RXTE spectral data for GX 3+1. ... Figure 4. ...

Еще в разделе: (Показать все результаты (>13) - uranus.sai.msu.ru/ )

• http://uranus.sai.msu.ru/~seif/apj_738_2_128_st11.pdf
• Tatjana Khruzina
• Katsova Livshits poster paper on CS-11