Institute of Mechanics , . Lomonosov Moscow State University , . ... Phone: +7 495 939 2039 . Fax: +7 495 939 0165 . E-mail: mailybaev imec.msu.ru . ... Mathematics . stability theory and dynamical systems . ... Physics and Mechanical Engineering . ... Engineering Faculty, University of l'Aquila, Italy . ... Department of Engineering Mechanics, Dalian University of Technology, China . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>34) - mailybaev.imec.msu.ru/ )

• "Moscow University" newspaper: article about Alexei A. Mailybaev
• Multiparameter Stability Theory with Mechanical Applications
• Curriculum Vitae of Dr Alexei A

... 960), Faculty of Philology, 1st Building of Humanities, Lomonosov Moscow State University, Vorob'jovy Gory, Moskva, 119899, Russia . ... Department of Russian Linguistics, . ... Getting of Ph.D. degree for a dissertation "Factors and Regularities of Analyticity Development in Language" (Moscow State University, Department of Structural and Computational Linguistics) . ... A member of Moscow University Academic Council for defending doctoral degrees in Slavic and Russian Linguistics (2001 - till now)...

Еще в разделе: (Показать все результаты (>88) - old.philol.msu.ru/ )

• HumLang - Human Language
• MSU-LGCLL:: DicTUM-1 - A System for Dictionary-Text Universal Manipulations and
• Khmelev D.V.- Disputed Authorship Resolution Using Relative Empirical Entropy

Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...

Еще в разделе: (Показать все результаты (>13) - www.fbm.msu.ru/ )

• http://www.fbm.msu.ru/sci/sno/POST%20CARD%202011.pdf

Regulation of cytochrome c peroxidase activity by nitric oxide and laser irradiation Osipov A.N., Stepanov G.O., Vladimirov Yu.A. , Kagan V.E. 1 2 Department of Medical Biophysics, Russian State Medical University, ul. ... This decomposition led to restoration of cytochrome c peroxidase activity. Finally, it can be concluded that nitric oxide and laser irradiation may serve as effective instruments for regulating the peroxidase activity of cytochrome c, and, probably, apoptosis. ...

Еще в разделе: (Показать все результаты (>131) - www.msm.biophys.msu.ru/ )

• MSM 2007
• Modern spectroscopy methods

HOMEPAGES OF MUSCLE PEOPLE or GROUPS AROUND THE WORLD . ... King's College, London . Michael Ferenczi . Imperial College of Science, Technology & Medicine, London . ... Michael Reedy . ... London Muscle Series . ... European Biophysical Societies' Association . European Society for Muscle Research . ... Argonne National Laboratory, USA  . ... Daresbury Laboratory, UK . MUSCLE-RELATED PERIODICALS . Biophysical Journal . ... The Journal of Physiology . ...

Еще в разделе: (Показать все результаты (>3) - muscle.imec.msu.ru/ )

... Department of Computational mathematics and cybernetics , Lomonosov Moscow State University . ... Thesis title "Machine learning approach for automatic performance tuning of parallel program", supervisor Dr. Nina N. Popova. ... High-performance computing, automatic performance tuning, machine learning algorithms, evolutionary and bio-inspired programming, parallel algorithms in VLSI design . ... Algorithms and framework for automatic selection and tuning parameters of parallel sparse linear solvers....

Еще в разделе: (Показать все результаты (>4) - angel.cmc.msu.ru/ )

... РАН Вл.В.Воеводин ( voevodin на parallel.ru ) Почтовая рассылка о новостях сервера. Выпуск 268 . 7 июля 2009 г. ------------- Компания Intel совместно с Российской корпорацией нанотехнологий ( Роснано ) при поддержке суперкомпьютерной программы СКИФ ... объявляют о старте второго ежегодного конкурса по применению высокопроизводительных вычислений Максимальная масштабируемость - 2009 . http ://ru. intel .com/business/community/?act=abouthpc2009 ------------- ЧТО НОВОГО? http :// ...

Еще в разделе: (Показать все результаты (>148) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #284 [06/04/2010]
• PARALLEL.RU - Новости, выпуск #329 [10/07/2012]
• PARALLEL.RU - Новости, выпуск #293 [01/09/2010]

... Полная версия этой страницы: набор в аспирантуру -- Johns Hopkins University . Студенческий форум Физфака МГУ > Физфак и учеба > Аспирантура . ... Факультет физики и астрофизики Johns Hopkins University объявляет набор студентов в аспирантуру на 2011/12 учебный год. ... http://physics-astronomy.jhu.edu/admiss/gr...dmiss_info.html . http://www.grad.jhu.edu/admissions/apply/index.php . ... Johns Hopkins University находится на севере города Балтимор (население 630 тыс.) в штате Мериленд. ...

Еще в разделе: (Показать все результаты (>750) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Аспирантура в Johns Hopkins University
• набор в аспирантуру -- Johns Hopkins University - Студенческий форум Физфака...
• Аспирантура в Johns Hopkins University - Студенческий форум Физфака МГУ

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Comparison of protein phylogeny reconstruction methods

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>3) - physcontrol.phys.msu.ru/ )

... Professional experience . ... Department of Geology. Chair of Dynamic Geology. ... Laboratory of Geodynamic Processes Modeling. ... 2001 Elaboration (together with V.Vadkovsky ) electronic version of textbook on course "Dynamic Processes in Geology" for students of 5th course and postgraduate students (MSU. ... 2000 - Delivering lectures and performing exercises with students on the course "Computer Simulation Of Geodynamic Processes" for students of 3rd course (MSU. ... Page design: їV.Zakharov . ...

Еще в разделе: (Показать все результаты (>36) - dynamo.geol.msu.ru/ )

• Publications of V.Zakharov
• Textbooks - INTRODUCTION TO TECTONOPHYSICS

INTERNATIONAL CONFERENCE HYDRODYNAMIC INSTABILITY AND TURBULENCE February 26 - March 05, Moscow, Russia ORGANIZED by Moscow State University, Institute of Mechanics of MSU and Faculty of Mechanics and Mathematics. ... SPONSORED by Russian Foundation for Basic Research, Moscow State University, Institute of Mechanics of MSU. ... Prospective participants must send abstracts in Word to the Organizing Committee (gertsens@imec.msu.ru) not later than 15 January 2006. ... Phone, E-mail and Fax number. ...

Еще в разделе: (Показать все результаты (>30) - hit-conf.imec.msu.ru/ )

• Moscow 2006
• Nonlinear Problems of Gydrodynamic Stability Theory
• Untitled

... He was graduated from Moscow State University, Faculty of Mechanics and Mathematics, and post-graduate course in a speciality Theory of Probabilities and Mathematical Statistics. ... Ph.D in mathematics in 1980 (Moscow State University, Faculty of Computer Science). ... Author of Popular Textbooks on Data Analysis and Statistics. ... He was graduated from Moscow State University in 1980. Ph.D in mathematics in 1988 (Moscow State University, Faculty of Mechanics and Mathematics). ... InCo . ...

Еще в разделе: (Показать все результаты (>6) - statsoft.msu.ru/ )

• InCO General Information In English

... ACAT'2003 : IX INTERNATIONAL WORKSHOP ON ADVANCED COMPUTING AND ANALYSIS TECHNIQUES IN PHYSICS RESEARCH (ACAT03), 1-5 December, 2003, Tsukuba, Japan. ... Advanced Statistical Methods for Data Analysis Traditionally, researchers from high energy and nuclear physics together with experts in computer science take part in the ACAT series of workshops. ... Thus, researchers from these and other fields are welcome to join us in discussions on modern computing techniques and ways for new developments. ...

Еще в разделе: (Показать все результаты (>82) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/hp-grants.html
• http://acat02.sinp.msu.ru/presentations/perret-gallix/ACAT2002.doc
• http://acat02.sinp.msu.ru/InfoBull1.txt

... Поиск по МГУ | ... Форумы > Новости МГУ > Тема . ... Good University Ranking Guide назвал журфак МГУ одной из семи лучших европейских школ, готовящих будущих журналистов . По версии Good University Ranking Guide , факультет журналистики Московского государственного университета имени М.В. Ломоносова стал одной из семи лучших европейских школ, готовящих будущих журналистов. Информация об этом опубликована на официальном сайте журфака МГУ. ... Новости МГУ . ... 2003 2011 MsuNews.Ru Новости МГУ . ...

Еще в разделе: (Показать все результаты (>267) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ | По данным QS World University Rankings лучше и
• MsuNews.Ru | Новости МГУ | Московский государтсвенный университет имени М.В.
• MsuNews.Ru | Новости МГУ | Студенты мехмата МГУ заняли пятое место на

... Faculty of Physics . ... Online journals . ... Access to the E-library is open from any computer in the intranet of the Faculty connected to the Internet. ... URL link: http://www.iop.org/EJ/ These journals can be accessed on-line from any computer in the intranet connected to the Internet. ... URL link: http://www.elsevier.com/wps/find/journal_browse.cws_home/P12?pseudotype= =Title 1Code=P12 =A These journals can be accessed on-line from any computer in the intranet connected to the Internet. ...

Еще в разделе: (Показать все результаты (>14) - www.phys.msu.ru/ )

• Alumni Association
• Faculty Staff
• Giving to the Faculty

... Process of Forming a Company - Discussion Question . ... You receive appropriate support from the University. Also University of Alberta statistics show that very few (less than 5%) technologies are successfully commercialized independently, whereas 50% of the technologies accepted by the University of Alberta are successfully commercialized. ...

Еще в разделе: (Показать все результаты (>32) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

... Laboratory of Medicinal Chemistry was established at the Department of Chemistry, Lomonosov Moscow State University in October 2013. ... We apply modern molecular modeling and chemoinformatics methods as well as develop new approaches. ... We have developed efficient methods for the analysis of quantitative structure-activity relationships and design of novel promising structures based on diverse theoretical approaches. ... Home . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>22) - qsar.chem.msu.ru/ )

• Sosnina, Ekaterina A. - Laboratory of Medicinal Chemistry
• Radchenko, Eugene V. - Laboratory of Medicinal Chemistry
• Palyulin, Vladimir A. - Laboratory of Medicinal Chemistry

RUSSIAN version . ... Sergei V. OGURTSOV . ... In 2002-2009 worked as a research scientist in the Department of Vertebrate Zoology of the Faculty of Biology MSU. Ph.D thesis entitled 'Learning the native pond odour as one of the mechanisms of chemosensory orientation of anuran amphibians' at Faculty of Biology MSU in 2004. ... Ogurtsov S.V., 2004. Olfactory orientation in anuran amphibians // Russian Journal of Herpetology, V. 11, ?1, p. 35-40. [download pdf-file] . Ogurtsov S.V., 2005. ...

Еще в разделе: (Показать все результаты (>72) - vertebrata.bio.msu.ru/ )

• Background of the Department
• Tatyana A.Ilyina
• Education

... MIT OpenCourseWare (бесплатные учебные курсы Massachusetts Institute of Technology ) . ... UCSB CS140 - Parallel Scientific Computing: Winter 2007 . ... Scientific Computing for Engineers (Prof. Jack Dongarra, Department of Computer Science (CS) at the University of Tennessee, Knoxville) . Introduction to Finite Element Methods (ASEN 5007) Fall 2007 (Department of Aerospace Engineering Sciences, University of Colorado at Boulder) . ...

Еще в разделе: (Показать все результаты (>10) - ani.cs.msu.su/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU
• Учебные курсы ведущих университетов мира | Кафедра автоматизации научных