... This information is needed for description of interaction of atom and ion with charge particles and photons. ... The project calculations are based on variational method and wave function expansion in a linear combination of hydrogen - like functions with effective charges. wave function of atoms, wave function of ions, cross section calculations, helium-like, variational method, Hartree - Fock, excited states, ionization, single excitation, double ionization, double excitation . ...
... Наука >> Вычислительная математика >> Теория и алгоритмы | ... 0 ] (обратно к тексту) Полная версия настоящего эссе: www.mi.ras.ru/~razborov/computerra.ps . 1 ] (обратно к тексту) S. Smale, "Mathematical problems for the next century", Mathematical Intelligencer , 1998, vol. 20, number 2, pages 7-15. [ 2 ] (обратно к тексту) А. Саломаа, "Криптография с открытым ключом", М.: "Мир", 1996. ... 6] А. Разборов, " P=NP , или Проблема перебора: взгляд из 90-х", www.mi.ras.ru/~razborov/phasis.ps . ...
Anisotropy of Cosmic Rays. Origins, experiments, data analysis problems & methods. ... ANTARES problems and methods. ... 2D» experiments Name Tibet Air Shower Array Position 90.522o E, 30.102o N; 4300 m above sea level 30.11 N, 4300m a.s.l. Gran Sasso, 2000m Caucasus, 1700m (40deg N, 113 deg W), atmospheric depth of 860 gm/cm2 Energy 4,6.2,12,50, 300 TeV Gamma /CR mix Time 1997-1999 TibetII, 1999-2001 TibetIII (bigger HD array). 4 years 1 year Statistics 7x109 in ~1000 days Rate Ang. ...
[
Текст
]
Ссылки http://antares.sinp.msu.ru/docs/Anisotropy_2011Bamberg.pdf -- 1353.8 Кб -- 16.12.2013 Похожие документы
... Commision on Soil Genesis, IUSS . ... Institute of Geography, Russian Academy of Sciences, Moscow . Institute of Ecological Problems of the North, Ural Branch of RAS, Arkhangelsk . ... Dokuchaev Soil Science Institute, Moscow . ... Prof. Dr. G.V.Dobrovolsky (Russia, Dokuchaev SSS President) . ... Prof. Dr. F.N.Yudakhin (Russia, Arkhangelsk Scientific Centre President) . ... Prof. Dr. Yu.G.Kutinov (Russia, Arkhangelsk, Director, Inst. ... Conference Secretariat . ... IV CONFERENCE ON CRYOPEDOLOGY . ...
... 6, 2011 A NEW NUMERICAL METHOD FOR THE SOLUTION OF THE BOLTZMANN EQUATION IN THE SEMICONDUCTOR NONLINEAR ELECTRON TRANSPORT PROBLEM N. A. Masyukov and A. V. Dmitriev UDC 538.935+517.958+537.84 Abstract. ... The method is based on the use of a mesh in the momentum space to represent the distribution function. ... Using this method, one can find the stationary distribution function as well as its time evolution. ... One can see that the distribution function is localized within the simulation area ...
[
Текст
]
Ссылки http://lizard.phys.msu.su/home/science/Masyukov-Dmitriev-11-JMathSci-InN.pdf -- 349.0 Кб -- 10.02.2011 Похожие документы
LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ AMPLITUDE EVOLUTION AND RUNUP OF SOLITARY WAVES ON A SLOPING PLANE Ahmet . ... 1999]; Carrier and Yeh, [2002]. ... Experimental data on runup of solitary waves are given among others by Hall and Watts, [1953], Pedersen and Gjevik, [1983] and Synolakis [1987], Shankar and Jayaratne, [2002], Lee and Raichlen, [2002]. ...
Magnetism Department MSU . ... Research groups . ... Students . Phd students . ... The basics of spintronics. prof . Vedyaev ю. Actual problems in modern magnetism . prof . Granovsky A. The physical basics of magnetism . associate prof . Kotel'nikova O. Magnetic phase transitions. associate prof . Kotel'nikova O. Physics of magnetic phenomena. associate prof . Kotel'nikova O. Introduction in group theory and its application in physics of magnetic phenomena. associate ...
... Master . ... Participants . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Gnedin Yu.N. Investigation of vacuum polarization in strong magnetic fields of neutron stars: Zel'dovich ideological impetus . ... Doroshkevich A.G. Beyond the limits of the LambdaCDM cosmology . ... Illarionov A.F. Title is discussed . ... Imshennik V.S. Title is discussed . ... Polnarev A.G. Polarization of CMB generated by Cosmological Gravitational Waves . ... Ruzmaikin A.A. A game of chance . ...
... Optical Zoomeron as a Result of Beatings of the Internal Modes of a Bragg Soliton B. I. Mantsyzov Faculty of Physics, Moscow State University, Vorob'evy gory, Moscow, 119992 Russia e-mail: mants@genphys.phys.msu.ru Received June 22, 2005; in final form, July 12, 2005 A new solution of two-wave MaxwellнBloch equations has been obtained analytically and numerically. ... The absence of losses on the emission of continuous spectrum waves indicates that the solutions found for the internal mode are...
... PhD thesis title: Gauge dependence of effective action in quantum gravity. ... Research fields of interest . Combustion: nonlinear development of the Darrieus-Landau instability of premixed flames, nonlinear flame stabilization and steady flame propagation, asymptotic methods, small gas expansion limit, non-perturbative description of curved flames, flame propagation in gravitational field, propagation of diffusion flames in counterflows. ... Gauge-independent effective gauge fields. ...
... Second-year students classes . ... The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... As a result, by the and this course, students acquire knowledge about the popular parallel programming techniques, knowledge of modern high-performance computing systems and practical skills to work with them. ... Moscow: Binom...
О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...
Межфакультетский курс «Математическое моделирование и численное исследование актуальных проблем физики плазмы» (Mathematical modeling and numerical research of the actual problems in the plasma physics) (весенний семестр 2015-2016 уч. г., 24 часа, зачет) Лектор: Козлов Андрей Николаевич, (м.т. 8-915-401-63-92, andrey-n-kozlov@mail.ru ) д.ф.-м.н., профессор кафедры вычислительной механики мех.-мат. факультета, зав. кафедры академик В.А.Левин Программа курса лекций проф. А.Н.Козлова 1. ...
[
Текст
]
Ссылки http://new.mfk.msu.ru/uploads/attachments/attachment_188_1454312707.doc -- 49.5 Кб -- 01.02.2016 Похожие документы
... A Primer from the Reform of Personal Income Taxation in Russia Introduction. ... However, to use the welfare function one needs to aggregate individual preferences that can also be unknown. ... The derivations lead to the conclusion that the optimal marginal income tax rate is increasing as the elasticity of labor supply increases. ... In this paper we obtain the characteristics of the labor supply for different population groups to get the elasticities of labor supply with respect to a post tax...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf -- 233.1 Кб -- 06.07.2014 Похожие документы
... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F velocity potential, H depth, vector of bottom deformation, 0 initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...
[
Текст
]
Ссылки http://ocean.phys.msu.ru/science/nosov/EGU2010_initial_condition.pdf -- 1885.8 Кб -- 12.01.2012 Похожие документы
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... News . ... 22.11.2005 PhD student Pavel Meskin and student Victor Maximov have participated in V scientific school "Actual problems of inorganic chemistry and materials science" which was held at Zvenigorod (Russia) from 18 to 22 November 2005. 01.09.2005 We have new colleague - first year student of Material Sciences Department Nikita Konoplev have started his scientific work at our group. ... Nicolas N. Oleynikov became a corresponding member of the Russian Academy of Sciences in 2000. ...
НЕЙРОСЕТЕВЫЕ МЕХАНИЗМЫ КОГНИТИВНОЙ ГИБКОСТИ А.Т. Терехин, Е.В. Будилова, М.П. Карпенко, Л.М. Качалова, Е.В. Чмыхова 1. ... Когнитивная гибкость нейронной сети определяется как актуальный диапазон изменения гладкости ее функции Ляпунова - большая гладкость облегчает нахождение стратегически эффективных направлений решения задачи, а меньшая необходима для проработки его деталей. ... При неизменных синаптических весах увеличение параметра гладкости приводит к увеличению гладкости функции энергии сети. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Rostov_Varifoc.doc -- 2025.0 Кб -- 09.06.2009 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы