... About Journal | ... Sociology and Political Science publishes original works on sociology and political science, results of research and experiments in social and political spheres in Russia and abroad, methodological innovations, information about conferences, reviews of the recent books in sociology and political science. ... Please include full article title both in Russian and English. ... Information about the author/authors both in Russian and English. ... References. ...
news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...
ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...
... Полная версия: Мелодии со Звездочки . Грация-МГУ::Форум > Мультимедия > Аудио . Ksafani . Jun 29 2007, 10:18 . ... На Звездочке ставили замечательное танго - Nelly Furtado, назывеется кажется "Say It Right". ... Цитата(Ksafani @ Jun 29 2007, 11:18) . ... Jul 1 2007, 09:45 . К сожалению точно не помню, кажется в D, хотя могу ошибаться... клип на песню(правда не в обработанном под танго виде), часто крутят на ТВ, все равно спасибо что посмотрели. ...
... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...
[
Текст
]
Ссылки http://www.protein.bio.msu.ru/~akula/Kulaichev%20Addition.pdf -- 75.3 Кб -- 29.10.2013 Похожие документы
Call for Papers September 26-30, 2016 National Cultural Center "Minsk", Minsk, Belar us ICONO/LAT 2016 Int' l Conference on Coherent and Nonlinear Optics (ICONO 2016) Int' l Conference on Laser s, Applications, and Technologies (LAT 2016) The leading event in the area of quantum electronics, laser physics, photonics and their applications. ... Russia Vladimir Belyi, Stepanov Inst. of Physics, NASB, Belar us ICONO Program Vice-Chairs Yulia Vladimirova, Lomonosov Moscow State Univ., ...
[
Текст
]
Ссылки http://iconolat16.phys.msu.ru/download/icono-lat-2016-fcp-reduced.pdf -- 656.9 Кб -- 29.01.2016 Похожие документы
. Адрес: 119992, ГСП-2, Москва, Ленинские горы, МГУ, Главное здание, А-1008 . тел.: (095) 939 37 67 факс: (095) 939 02 59 . Все права на материалы, опубликованные на сайте Управления, принадлежат МГУ им.М.В. Ломоносова. При использовании материалов сайта ссылка на наши выходные данные обязательна. Просим сообщать нам о замеченных неточностях и опечатках. Webmaster . 2002-2005 УОСиП МГУ All rights reserved .
Title Should Be in Bold, 18-Point Type and Centered, Please Use Title Case Author name(s) [10-point type, centered, bolded] Author affiliation and full address (8-point type, centered, italicized) Author e-mail address: (8-point type, centered, italicized) Abstract: Indent left and right margins 0.5 in. (1.27 cm), justify the paragraph (on both right and left), and use the same font as in the body of the paper. ... 5] Author(s), "Title of paper," in Title of Proceedings, Name(s), ed(s)., ...
[
Текст
]
Ссылки http://iconolat13.phys.msu.ru/ICONO_LAT-2013/Guidelines_files/Meetings-Style-Guide.pdf -- 128.6 Кб -- 26.01.2013 Похожие документы
Форум МГУ Главная Помощь > . ... BB-коды . ... Делает выделенный текст полужирным, наклонным, подчеркнутым или зачеркнутым. Пример: . Это [B]полужирный[/B] текст. ... Вывод: . ... Изменяет цвет, шриф или размер выделенного текста. ... Создать ссылку из выделенного текста. ... URL]http://www.example.com[/URL] . ... Делает выделенный текст ссылкой на интернет-страницу или адрес e-mail. ... Показывает картинку, используя выделенный текст как URL . ... Увеличивает отступ выделенного текста. ...
... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... Вакансии . ... Информация о компании: Procter . ... BECOME A SUPPLY CHAIN LEADER! The mission of the Supply Network Operations team in P&G is to transform consumer demand into a supply plan and deliver the products to the shelves so that right P&G products are at the right place at the right time - and at the right cost and are available to P&G Consumers. ... Qualifications to succeed in Supply Network Operations: . ...
Faculty of Physics of Lomonosov Moscow State University . ... Department of Photonics and Microwave Physics is one of the largest departments of Faculty of Physics of Lomonosov Moscow State University . ... Our department holds annual conference on wave phenomena in nonhomogeneous media, physics and applications of microwaves in May in Moscow suburb. ... Physics of microwaves . ... Department of Photonics and Microwave Physics . Faculty of Physics . Lomonosov Moscow State University . ...
... Quick Links ------------------------------- Address Laboratory now Equipment Administration Staff Web-pages Workgroups pages Phone-book, e-mail News Research Grants Publications Education Site Search . The Laboratory of Catalysis and Gas Electrochemistry (CGE) was organized in 1947 on the basis of the Laboratory of Inorganic Catalysis which existed on the Department of Chemistry since 1931. ... Copyright 2001, Laboratory of Catalysis and Gas Electrochemistry, Web-design A.N. Kharlanov. ...
... 7 / OPTICS LETTERS 1571 Plasmon ruler with gold nanorod dimers: utilizing the second-order resonance Maxim R. Shcherbakov,1 Anton T. Le,1 Natalia Dubrovina,2 Anatole Lupu,2 and Andrey A. Fedyanin1,* 2 Faculty of Physics, Lomonosov Moscow State University, Moscow 119991, Russia Univ. ... As a result, the input polarization state was always set to be parallel to the nanorods. ... This graph straightforwardly indicates the difference between the 1st- and 2nd-order resonances in plasmonic nanorod dimers...
... Gaseous discs in NGC 252 and in NGC 4513 have decoupled kinematics, and the ionized gas of their rings is certainly excited by young stars. ... Two other, quite isolated S0 galaxies with the UV rings, IC 522 and NGC 446, demonstrate the shock-dominated gas excitation in the UV-detected rings, so their rings may probably have impact origin. ... NGC 4513. ... The UV rings in isolated galaxies IC 522 and NGC 446 may represent the consequences of central impact by a satellite from a highly inclined...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Useful Information . ... Vestnik CIE (in Russian) . ... Information about Russia . ... With an area of 17,075,200 square kilometres, it is the largest country in the world by land mass, covering almost twice the territory of the next-largest country, Canada. ... Formerly the dominant republic of the Union of Soviet Socialist Republics (USSR), Russia is now an independent country and an influential member of the Commonwealth of Independent States, since the Union s dissolution in December 1991. ...
... Manuscripts are classified in size into the three categories: . ... The most stringent requirements are imposed on manuscripts of the first category. ... Manuscripts of the second category should contain a representation of main results without excessive details in conclusions and proofs. ... Manuscripts should be prepared in electronic form using LaTeX 2.09 (see the instructions for manuscript preparation in electronic form) . ... The manuscript should be signed by its author(s). ...