XIV " : " .. 24­26 2011 . 200 . This is a review of the 14th International conference "Russia and the West: the Dialogue of Cultures" organized by the Faculty of the Foreign Languages and Area Studies of the Moscow State Lomonosov University on November 24­26, 2011. ... Key words: conference, Moscow State Lomonosov University, area studies, history, philology and linguistics, cultural studies. ... XIV " : ". 300- .. . ...

Еще в разделе: (Показать все результаты (>164) - ffl.msu.ru/ )

• Research

Dear friends, It is less than three weeks left till the 39th IChO starts. ... Currency and cards. Russian rouble is the only currency accepted throughout Russia. ... To attention of Head mentors intending to pay fees on arrival in cash: payments will be accepted in Russian roubles only. ... During the IChO, mentors and guests will stay in Holiday Inn Sokolniki, and students in the Olympian camp, which is also an option for early arrivals and late departures. ... The 39th IChO Organizing Committee ...

Еще в разделе: (Показать все результаты (>3) - icho39.chem.msu.ru/ )

Table 1. ... Areas: 1 - central waters; 2 - the Bay of Riga; 3 - the Lithuanian coast; 4 - the Bay of Gdansk; 5 - the Pomorskaya Bay; 6 - the coastal waters between 4 and 5;. * - the results were averaged over several measurements. ... 12-15 . ... 134 . ... 124 . ... 140 . ... 145 . ...

Еще в разделе: (Показать все результаты (>16) - www.biophys.msu.ru/ )

• (Chlorophyll Fluorescence in vivo: A Theory
• Как отмечалось выше, обилие (по Fo) и фотосинтетическая активность

... Center For International Education . Lomonosov Moscow State University . ... This year on October, 17 the Center for International Education of Lomonosov Moscow State University starts a new studying programme ?Evening Moscow?. ... Ministry of Education and Science of the Russian Federation and the Centre for International Education of the Lomonosov Moscow State University are holding XIII International Olympiad of the Russian language for schoolchildren using distance technologies. ...

Еще в разделе: (Показать все результаты (>295) - www.cie.ru/ )

• Center for International Education - News Archive
• Apply Online
• Le Centre de l'?ducation International :: L'Universit? de l'?tat de Moscou M.

Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...

Еще в разделе: (Показать все результаты (>21) - sbmg.geol.msu.ru/ )

• Sonenshain
• China

... You have to choose only one answer among the suggested options; for tasks 1-4 write down `agree' beside the answer you choose. ... Peptide bond between amino acids in a molecule of protein is underlaid by: a) b) c) d) the principle of complementarity; insolubility of amino ac ids in water; solubility of amino acids in water; the presence of carboxy and amino group; Task 2. ... There are ten cards, each with one side white and one side black. ... What is your understanding of the word "progress"? ...

Еще в разделе: (Показать все результаты (>230) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/people/izmailov/2001-izmailov_dzhafarov_zimachev.pdf
• http://www.psy.msu.ru/science/psyrussia/2009/lebedinsky.pdf
• http://www.psy.msu.ru/science/psyrussia/2012/kozlovskiy.pdf

... Font: Times New Roman . ... size - А4 (21 cm х 29,7 cm) . ... Title should be typed in capital letters, Times New Roman, size 13, boldface font; formatting: center. ... The title and the number of the table should be center-formatted (Times New Roman, size 11, single-spaced, no period/full stop at the end of the title). ... The title under the illustration should be center-formatted (Times New Roman, size 11, single-spaced, no period/full stop at the end of the title). ... Use Times New Roman size...

Еще в разделе: (Показать все результаты (>73) - www.spa.msu.ru/ )

• Visa Support Information

http://hcch.e- vision.nl/index_en.php?act=conventions.status cid=41 на 05-02-2009 [pic] Last update: Number of Contracting States to this Convention: 95 [pic] 1) S = Signature 2) R/A = Ratification or Accession 3) Type = R: Ratification; A: Accession ; A*: Accession giving rise to an acceptance procedure; click on A* for details of acceptances of the ... 1 |D13 | ... Austria |5-X-19|14-XI-|R |13-I-1| ... Su |24-I-1| ... 965 | ... China, People's Republic| ... 1999 | ... 006 |006 | ... 006 | ...

Еще в разделе: (Показать все результаты (>19) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2009/twomey.doc

... Davis Center for Russian Studies at Harvard University. The Center aims at developing of fundamental knowledge about Russia, its culture, and its institutions. The Center also examines Russia in its regional and historical context, and welcomes and supports the study of neighboring countries that have been either integrated with, or subordinated to, the Russian state at various periods in history, or whose experience poses intellectual problems similar to those of Russia. ...

Еще в разделе: (Показать все результаты (>39) - suny.msu.ru/ )

• Центр по делам России и США :: Другие проекты в России
• Центр по делам России и США :: Публикации

ARM . 12: · ARM 2 ARM Powered Products 3 ARM · 4 · ARM 32- . ARM : ­ Byte - 8 bits ­ Halfword - 16 bits ( ) ­ Word - 32 bits ( ) · ARM ­ 32-bit ARM Instruction Set ­ 16-bit Thumb Instruction Set 5 · ARM : ­ User : , ­ FIQ : , high priority (fast) ­ IRQ : , low priority (normal) ­ Supervisor : Software Interrupt instruction ­ Abort : ­ Undef : ­ System : , 6 User ARM Current Visible Registers Abo Und rtMod SVCMode IRQ ef Mode FIQ Mode e User ...

Еще в разделе: (Показать все результаты (>7) - lvk.cs.msu.su/ )

Presented on 9 January 2003 Magnetization-induced second-harmonic SH generation is studied in magnetophotonic crystals formed from a magnetic garnet spacer located between two dielectric Bragg reflectors, at the resonance of the fundamental radiation with the cavity mode ... The spectrum of the Faraday rotation angle of the linearly polarized wave also has a peak at the microcavity mode where rotation enhances till approximately 1.5°. ... The SH wave is strongly linearly polarized. ...

Еще в разделе: (Показать все результаты (>45) - shg.phys.msu.ru/ )

• http://shg.phys.msu.ru/ruscon/articles/pdf/96_PhysRevB_54.pdf
• http://shg.phys.msu.ru/ruscon/articles/pdf/97_PhysRevLett_78.pdf
• http://shg.phys.msu.ru/ruscon/articles/pdf/04_PRB70_12407.pdf

faq ]] . CompHEP . ... Installation . ... Q: When I try to display squared diagrams for 6 final particles the CompHEP stops . ... Read the FAQ page, . ... Old versions of CompHEP (e.g. 33.23, see the 'Downloads' page) could be installed on HP, SUN and DEC platforms. ... The installation of some versions earlier than 4.4 on 64bit lxplus.cern.ch machines, where 32bit libisajet and libmath from cernlib are found by ./configure in the directory /cern/pro/lib may require the following steps: . ...

Еще в разделе: (Показать все результаты (>19) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]

People . ... N. A. Brazhe . ... The Cell biophysics group unites a number of laboratories at the Biophysics Department of the Biological Faculty, Moscow State University, Russia. We aim at a deeper understanding of cellular and intercelullar processes. The use of a wide spectrum of experimetnal techniques as well as an advanced data series analysis helps us in our quest for a better knowledge of cell biophysics. ...

Еще в разделе: (Показать все результаты (>4) - cell.biophys.msu.ru/ )

A full system of equilibrium differential equations for the finite number of suspension lines (n = 28) of square parachute is derived. ... One can determine the shapes of inflated canopy radial cross-sections, stress distribution of radial ribbons on the canopy surface and fabric stress between them, drag coefficients for various line lengths and air-permeability by means of computer simulation. ... Initially, this problem was solved assuming D p = const over total canopy of square parachute. ...

Еще в разделе: (Показать все результаты (>9) - margaret.imec.msu.ru/ )

• Large-Scale Load Stabilization

... heat and mass transfer; . kinetic theory of gases; . ... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...

Еще в разделе: (Показать все результаты (>10) - lab106.imec.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>9) - npidb.belozersky.msu.ru/ )

• NPIDB: Interaction classes
• NPIDB: Families of interaction class

... News . ... TLE news . ... Publications on Transient luminous events . ... The UHECRs will be detected through the measurement of the emission in the range between 290 and 430 nm, where some part of Transient Luminous Events (TLEs) emission also appears. ... Luminous event parameters (atmosphere altitude, energy released to radiation, and temporal pro?les) are similar to observed elsewhere parameters of transient luminous events (TLE) of elves, sprites, halo, and gigantic blue jets types. ...

Еще в разделе: (Показать все результаты (>42) - uhecr.sinp.msu.ru/ )

• Global transients in ultraviolet and red-infrared ranges from data of
• JEM-EUSO
• UHECR news

... About hotel . ... Contacts . ... The hotel т??69th Parallelт?? is glad to present its renewed website which now has an option of online booking! ... Reception . ... 8152) 25-37-00 . ... Bus number 106 (the last stop), then - from the stop "Railway Station Square" (near the pavilion with flowers) to stop the "Valley of coziness" bus number 1 or number 61 shuttle . From the railway station (bus stop "Railway Station Square" - near the pavilion with flowers to stop the "Valley of coziness"): . ...

Еще в разделе: (Показать все результаты (>3) - 69parallel.ru/ )

... Home Our Team Staff Gennady F. Voronin . ... Bio : Was born in Moscow region , USSR (1935). Graduated and post-graduated from the Moscow State University (1958 and 1960)., ... Work at the Department of Chemistry of the Lomonosov Moscow State University: Junior Research Fellow (1960), Senior Research Fellow (1966), Head of the research laboratory of Chemical Thermodynamics (1976 - present). ... Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• Carbamide Laboratory of Chemical Thermodynamics

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search