... Ganin I.P., Kaplan A.Ya. ... Ganin I.P., Shishkin S.L., Kaplan A.Y. A P300-based brain-computer interface with stimuli on moving objects: four-session single-trial and triple-trial tests with a game-like task design. ... Kaplan A.Y., Shishkin S.L., Ganin I.P., Zhigalov A.Y. Adapting the P300-based brain-computer interface for gaming: a review. ... Shishkin S.L., Ganin I.P., Basyul I.A., Zhigalov A.Y., Kaplan A.Y. [P300-based brain-computer interface: the N1 wave and the distractor problem.] ...

Еще в разделе: (Показать все результаты (>40) - brain.bio.msu.ru/ )

• S.Borisov
• 'Московский ИМК' - исследования по интерфейсу мозг-компьютер (управление "силой
• Publications of the Lab. for Neurophysiology and Neuro-Computer Interfaces,

... GeneBee . ... Courses in Bioinformatics . ... What is GCG? ... Usage of GCG Package on GeneBee Server . ... What is WhatIf? ... Computer Class . ... Due to colaborate work of many laboratories the total length of published nucleotide sequences is now . ... GCG vs. ... Usage of GCG Package on GeneBee server . ... Computer class . ... Computer class is used for bioinformatic courses and for scientific semenars. ... Everyone who need a consultation for GeneBee service, GCG or WhatIf package is welcomed...

Еще в разделе: (Показать все результаты (>110) - www.genebee.msu.ru/ )

... Pyrococcus furios (14506) [f] 149 41.9 3.6e-05 AE010241 AE009950 |AE010241| ... Pyrococcus furiosus DSM 3 (14506 nt) initn: 141 init1: 116 opt : 149 Z-score: 163.3 bits : 41.9 E(): 3.6e-05 banded Smith-Waterman score: 149; 78.8% identity (78.8% similar) in 52 nt overlap (19-69:9586-9637) 10 20 30 40 U00096 TGGTGCTGATACCCAGAGTCGAACTGGGGACCTCACCCTTACCAAGGG : :::: ::::::: : ::::::::: : AE0102 TTATTAAAAACATGGAGCCCCGGCCGGGCTTTGAACCCGGGACCTGCCGCTTACCAAGCG 9560 9570 9580 9590 9600 9610 50 60...

Еще в разделе: (Показать все результаты (>909) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.su/FBB/Moscow-advert.doc
• http://kodomo.cmm.msu.ru/~nihilenia/term2/B.msf
• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt

... Authors: Jose M. Madiedo et al. arxiv:1402.2644 Вращающаяся пара сверхмассивных черных дыр выявлена по данным VLBI наблюдений джетов S5 1928+738 (A spinning supermassive black hole binary revealed by VLBI data on the jet of S5 1928+738) . ... обзор arxiv:1402.0867 Большие вопросы в звездообразовании: темп звездообразования, звездные скопления и начальная функция масс (The Big Problems in Star Formation: the Star Formation Rate, Stellar Clustering, and the Initial Mass Function) . ...

Еще в разделе: (Показать все результаты (>366) - astro.uni-altai.ru/ )

• Обзоры препринтов astro-ph

... Содар . Профилемер . Соник 5 м . ... Профилимер ЗНС . ... Данные . ... Содар Профилемер Соник 5 м Соник 10 м Профилимер ЗНС . ... Если Вас заинтересовали наши данные, ображайтесь к нам . ...

Еще в разделе: (Показать все результаты (>2) - atm007-3.phys.msu.ru/ )

. Sluices of Moscow canal, Tushino. September 1959.

Еще в разделе: (Показать все результаты (>47) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/My_life_in_photos/My_life_history_in_photos/plaza_mayor.htm
• http://chaos.phys.msu.ru/loskutov/PDF/JSPstadium(t).pdf
• Staff

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

148. http://mguteam.chat.ru/stad1.html