. QM/MM approach is applied to modelling of GTP hydrolysis reaction mechanism. We use X-ray structure as initial atom coordinates for QM/MM calculations. We consider 2 systems: free EF-Tu and complex with ribosome.
... For the investigations of the phenomenon leading to non inflation (squidding) of parachute, the influence of canopy permeability and upstream flow on the character of pressure distribution along framework model, imitating round parachute, was studied experimentally. ... The pressure sensors: 13 ones inside and 13 - outside the canopy have been placed for the study of distribution of internal and external pressure on the surface of the model. ... Variant 1. ... Parachute Science] . ...
Problems for Ultrahyperbolic Equations in Half-Space Prof. Dmitry P. Kostomarov Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Pontryagin Anniversary Conference June 1722, 2008 , Moscow, Russia Section Differential Equations Subsection Partial Differential Equations Prof. D.P. Kostomarov (CMC MSU) Problems for Ultrahyperbolic Equations June 22, ... June 22, 2008 (2.13) Problems for Ultrahyperbolic Equations 16 / 23 2.2. ...
[
Текст
]
Ссылки http://ani.cs.msu.su/files/kostomarov-pontryagin2008.pdf -- 414.5 Кб -- 22.06.2008
[
Текст
]
Ссылки http://ani.cmc.msu.ru/files/kostomarov-pontryagin2008.pdf -- 414.5 Кб -- 22.06.2008 Похожие документы
... Опубликовано Февраль 21, 2015 Март 6, 2016 Автор aislepkov . Mr WordPress : . Февраль 21, 2015 в 3:37 пп . Hi, this is a comment. To delete a comment, just log in and view the post's comments. ... Ваш e-mail не будет опубликован. ... E-mail * . ... Можно использовать следующие HTML -теги и атрибуты: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong> . Сайт работает на WordPress ...
F aculty of Physics at Moscow State University is well-known in Russia and beyond its borders not only for its excellent research and education, but for traditions of students' life, as well. ... A long with the fresh students, many graduate students and faculty members participate in this even, as well. ... T he most favorite holiday among students of Physics at Moscow State is the renowned " Day of Physicist ", traditions of which go back in 1960, when it used to be called "The Archimedes Day". ...
... Applications of Molecular Mechanics to Metal Complexes" . ... Molecular mechanics study of the mixed-ligand lanthanide complexes using Gillespie-Kepert model . ... Within MM-GK, the same parameters are applicable to complexes of different coordination numbers/polyhedra. ... Gillespie-Kepert model . ... Using derived computational parameters, we calculated the geometry of 39 lanthanide ion nonaaqua complexes, 6 octaaqua complexes and 18 beta- diketonate and aqua-beta-diketonate complexes. ...
... ADSP2181 Data Sheet. ... ********************* ********* * * This sample program is organized into the following sections: * * Assemble time constants * Interrupt vector table * ADSP 2181 intialization * ADSP 1847 Codec intialization * Interrupt service routines ********************************************************* ********* .module/RAM/ABS=0 loopback; {************* ... transmit i? 68 |||! |||! |||+============= control bit ||+-------------|+--------------control bit +---------------- ! ...
Wavelet Analysis of E852 Experimental Data V. L. Korotkikh and L. I. Sarycheva Scobeltsyn Institute of Nuclear Physics, Moscow State University, Moscou 119899, Russia Abstract. A calculation of background in the hp 0 mass spectrum by the wavelet analysis is presented. ... A large final state statistics of E852 experiment [4, 5, 6] in the p p interactions at 18 GeV/c allows to use the wavelet analysis both for onedimensional and for two dimensional distributions. ... are built (fig. ...
The shower approach in the simulation of ion scattering from solids V.A. Khodyrev, R. Andrzejewski, A. Rivera, D.O. Boerma, and J.E. Prieto Centro de Microan‡lisis de Materiales and Instituto Universitario "Nicol‡s Cabrera", a a Universidad Aut‡noma de Madrid, E-28049 Madrid, Spain o For basic studies of ion-solid interactions as well as for the retrieving of reliable structural information from ion scattering exp eriments, accurate simulations of swift ion-solid interactions are essential. ...
[
Текст
]
Ссылки http://danp.sinp.msu.ru/LIIWM/ArXiv-0904.2151v1_Khodyrev2009.pdf -- 850.9 Кб -- 22.05.2010 Похожие документы
... In the spring semester, 2009, Fundamentals of Nanotechnology an interfaculty course prepared by ERC was given to third-year students of Faculties of Physics, Chemistry, Biology, Mechanics and Mathematics, Materials Science, Bioengineering and Bioinformatics, Fundamental Medicine. ... Приглашение на осеннюю школу-конференцию по Органической электронике 21?26 сентября 2014 года . ... XIII конференция студентов и аспирантов Научно-образовательного Центра по физике и химии полимеров 29 ноября 2013 года ...
Theoretical problems of electrical double layer structure on ideally polarizable electrodes and reversible adsorption of ions and neutral organic molecules on electrodes are considered, and also the specific features of kinetics of multistep electrochemical processes limited by mass transfer, electron transfer and chemical reaction. Special attention is paid to computer simulation of specific adsorption and coadsorption of ions and neutral organic molecules on the electrode surfaces. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Dear friends, It is less than three weeks left till the 39th IChO starts. ... Currency and cards. Russian rouble is the only currency accepted throughout Russia. ... To attention of Head mentors intending to pay fees on arrival in cash: payments will be accepted in Russian roubles only. ... During the IChO, mentors and guests will stay in Holiday Inn Sokolniki, and students in the Olympian camp, which is also an option for early arrivals and late departures. ... The 39th IChO Organizing Committee ...
[
Текст
]
Ссылки http://www.icho39.chem.msu.ru/html/english/Participation/Pre-arrival%20circular.pdf -- 9.7 Кб -- 29.06.2007
[
Текст
]
Ссылки http://icho39.chem.msu.ru/html/english/Participation/Pre-arrival%20circular.pdf -- 9.7 Кб -- 29.06.2007 Похожие документы
... Квантовая теория . ... КВАНТОВАЯ ТЕОРИЯ ПОЛЯ [7-й-8-й семестры] (проф. СЛАВНОВ Д.А.) . ... СОВРЕМЕННЫЕ ТЕОРЕТИЧЕСКИЕ ПРОБЛЕМЫ ФИЗИКИ ВЫСОКИХ ЭНЕРГИЙ [10-й семестр] (с.н.с. САМОХИН А.П.) . ... проф. СЛАВНОВ Д.А. Квантовая теория поля описывает фундаментальные законы современной физики. ... Квантовая теория поля является теоретической основой физики высоких энергий и физики элементарных частиц. ... Квантовая теория поля и физика фундаментальных взаимодействий. ... Введение в квантовую теорию поля. ...
Архитектура ЭВМ и язык ассемблера . Страница поддержки курса "Архитектура ЭВМ и язык ассемблера" для 1 потока . ... Ассемблер nasm . ... Начало работы под cygwin . Установка cygwin . ... Материалы . ... Материалы лекций . ... Материалы факультатива . ... Итоги коллоквиума ?1 . ... Рис.љ ... На данном этапе у Вас явно запрашивают с какого именно сервера выкачивать cygwin (Рис.љ ... На данном этапе Вам предлагают выбрать какие именно программы будут установлены в среде cygwin (Рис.љ ...
... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...
... Separation of all runs on several groups by mean active sectors. ... Ways to carry out step 2: trying to cut off all points which don't reach the fit line with errors. Ways to carry out step 2: mean active sectors selection Ways to carry out step 2: results of mean active sectors selection by example of set 2 Failing of mean active sector selection method on example of set 3: one point is still on the graph Introduction of new distance parameter How to find an optimal distance parameter? ...
The beamer class Manual for version 3.06. \begin{frame} \frametitle{There Is No Largest Prime Number} \framesubtitle{The proof uses \textit{reductio ad absurdum}.} \begin{theorem} There is no largest prime number. \end{theorem} \begin{proof} \begin{enumerate} \item<1-| alert@1> Suppose $p$ were the largest prime number. \item<2-> Let $q$ be the product of the first $p$ numbers. \item<3-> Then $q+1$ is not divisible by any of them. \item<1-> Thus $q+1$ is also prime and greater than $p$.\qedhere
... Excess of power . Power excess . ... Excess specific energy . ... A small amount of excess pressure is provided . ... Excess coordinates . ... Beam bending . ... Bending state . ... Изменение в обозначениях . Notational change . ... Variation of momentum . ... Импульс давления . The impulsive boundary motion produces a pressure impulse in the fluid . Influence of various factors on the air pressure pulse from passing trains . ... Integral of odd (even) degree . ... Integrated circuit . ...
... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...