Next: Star Formation Rate and Up: No Title Previous: Calculation of Evolutionary Tracks . To start calculations, we choose the distributions of the initial binary parameters: the mass of the primary ZAMS component, , binary mass ratio, , orbital separation a . ... whereas the mass ratio distribution is not. ... The zero assumption often made is that the mass ratio distribution has a flat shape, that is binaries with a high mass ratio occur as frequently as those with equal masses. ...

Еще в разделе: (Показать все результаты (>655) - xray.sai.msu.ru/ )

• Parameters of binary compact star evolution
• Dependence on the Scenario Parameters and Initial Distributions
• Initial binary parameters

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...

Еще в разделе: (Показать все результаты (>26) - antares.sinp.msu.ru/ )

... The Radon transform (also known as the Hough transform) is formulated as a family of line integrals through a two-dimensional function. ... The Radon transform provides us with a simple means of computing the FF plane of the autochirplet transform, by using the Wigner distribution, and arriving at a transform space that tells us basically the same information as the chirplet FF-plane, except that we benefit from the greater resolution of the Wigner distribution. ...

Еще в разделе: (Показать все результаты (>9638) - crydee.sai.msu.ru/ )

• The pyramidal (multi-resolution) CCT
• Tutorial on Fortran 90, Digital UNIX
• The Frequency-Frequency (FF) Plane

... In studies such as those of Dziewonski [1984 ], Woodhouse and Dziewonski [1984 ] or Tanimoto [1990 ] it was assumed a priori that the lateral variations in the structure could be represented by a spherical harmonic expansion truncated at some low degree such as 6 or 8. ... A very similar spectrum (up do degree 8) is obtained by predicting the SS data from 3-D models such as an upper mantle model M84C [ Woodhouse and Dziewonski, 1984 ]. ... U.S. National Report to IUGG, 1991-1994 . ...

Еще в разделе: (Показать все результаты (>804) - geo.web.ru/ )

ABOUT ONE METHOD OF CALCULATION AVERAGE VALUE OF THE PARAMETER USING MEASUREMENTS' WEIGHTS Mitina O.V., Mitin V.I. 1 MSU, dept. of psychology, 125009, Moscow, Mokhovaya.11, b. 5, omitina@yahoo.com Russian Research Center "Kurchatov Institute", valentinmitin@yahoo.com. ... Here we suggest the following method iterative algorithm calculating. ... Weight functions on an iterative step j are calculated using the formula wij = 1 j 2 exp[( N i - N N i wij wij j- 1 ) 2 / 2 2j ] . ...

Еще в разделе: (Показать все результаты (>385) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc184890/eng.pdf

Электронная библиотека Попечительского совета . ... Smith R.C., Demetriou M.A. - Research Directions in Distributed Parameter Systems . ... Название: Research Directions in Distributed Parameter Systems . Авторы: Smith R.C., Demetriou M.A. Аннотация: . ... Research Directions in Distributed Parameter Systems is intended for graduate students, academic and industrial research scientists, and program managers from funding agencies supporting research focused on distributed parameter systems. ...

Еще в разделе: (Показать все результаты (>23073) - lib.mexmat.ru/ )

• Ali I., Aboul-Enein H.Y. - Chiral Pollutants: Distribution, Toxicity and
• Mason R.L., Gunst R.F., Hess J.L. - Statistical Design and Analysis of
• Tiba D. - Optimal Control Of Nonsmooth Distributed Parameter Systems by Dan

Next: Defining the Local Mailer Up: Typically Used sendmail.m4 Parameters Previous: Typically Used sendmail.m4 Parameters . LIBDIR defines the directory where sendmail+IDA expects to find configuration files, the various dbm tables, and special local definitions. ... To change the location of the support files to a different location, remove the leading dnl from the above line, set the path to the desired location, and rebuild and reinstall the sendmail.cf file. ...

Еще в разделе: (Показать все результаты (>584) - itpm.msu.su/ )

• Typically Used sendmail.m4 Parameters
• Sendmail+IDA
• Defining the Local Mailer

Online Services | ... Nuclear Wallet Cards" . USA National Nuclear Data Center - NNDC . ... Nuclei Selection: . All nuclei Only even Only odd . ... Decay Type: . decay . ... CDFE Head: Vladimir V. Varlamov . ...

Еще в разделе: (Показать все результаты (>40) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Nucleus Ground State Parameters
• CDFE => Online services => Chart of Nuclear Quadrupole Deformations
• CDFE => Online services => Chart of nucleus shape and size parameters

Maximization of Sensitivity of the PH-Premium for Families of Pareto Distributed Risks / Irkhina N.A. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>243) - vestnik.math.msu.su/ )

Abstract In this graduation work, results of numerical calculations of fundamental mode for lasers with nonuniform unsaturable gain ditribution are presented. ... Fundamental mode of lasers with resonators of critical configurations essentially differs from gaussian mode of bare resonator even at rather small gain. If values of g1 and g2 considerably differ from each other, structure of fundamental mode comes nearer to gaussian even for resonators with critical configurations. ...

Еще в разделе: (Показать все результаты (>260) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2007/Zjabko_Parashuk_en.pdf

... CompHEP Models. ... CompHEP is based on an idea of the physical model. ComHEP Models are very simular to physical models in high energy physics, like Standards Model or MSSM. ... Two of them are versions of the Standard Model (SU(3)xSU(2)xU(1)) in the unitary and t'Hooft - Feynman gauges. ... Standard Model in Feynman gauge . ... This output can be written in LaTeX format and in the form of CompHEP model files, which allows one to start calculations of processes in the new physical model. ...

Еще в разделе: (Показать все результаты (>16) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]

... Stationary distribution for the Jacobi equation with a large random curvature parameter" . Illarionov E.A. A generalization of the results obtained previously for the case when the curvature parameter of the Jacobi equation is a random quantity distributed on a large or infinite interval is proposed. ... Keywords: stationary distribution, product of matrices, integral equation, Jacobi equation . ...

Еще в разделе: (Показать все результаты (>566) - num-meth.srcc.msu.ru/ )

• "Numerical aspects of the calculation of scaling factors from experimental...
• "Inverse problems of formation for the molecular-weight distribution in
• "Stability analysis of the lattice Boltzmann schemes for solving the diffusion

... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>8) - margaret.imec.msu.ru/ )

• Air-Permeability Influence on Pressure Distribution Character
• On Square Parachute Differential Equations

Use the %INCLUDE{...}% variable to embed the content of another topic or web page inside a TWiki topic. ... Syntax Example . ... Include a topic MyTopic with two parameters . ... Alert Box using Parameterized Include . INCLUDE{ "page" pattern="reg-exp" rev="2" warn="off" section="clients" PARAMETER1="value" PARAMETER2="Some value"}% . ... Note: All text of a topic is included unless it contains a %STARTINCLUDE% and %STOPINCLUDE% , or you specify a section parameter and/or a pattern parameter. ...

Еще в разделе: (Показать все результаты (>41557) - dualopt1.cmm.msu.ru/ )

• IncludeTopicsAndWebPages - TWiki - TWiki
• %TOPICTITLE% (17 vs. 18) - TWiki
• %TOPICTITLE% (2 vs. 3) - TWiki

Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . You may download the latest source code distribution and install the period search service at your own web server. ...

Еще в разделе: (Показать все результаты (>4) - scan.sai.msu.ru/ )

... Improvement of Methods and Means of Nonlinear Acoustics for Diagnostics of Concrete of Massive Items, Constructions and Structures . ... For want of distribution of elastic waves in a medium have heterogeneity (located defects, stratification, crack) the performances of an information signal, for example, velocity of distribution, amplitude, spectral component can change the parameters [1]. ... These performances are treated on the specially developed algorithm. ...

Еще в разделе: (Показать все результаты (>458) - acs366.phys.msu.su/ )

• Schedule : Modern Group Analysis (MOGRAN 9)

... 2.5 ISR 63 GeV |y| 2 NA5 19 GeV |y| 1.5 ISR 31 GeV |y| 2 N_ch 2 Regge-Gribov multipomeron approach Probability of production of n pomerons ' ' where n ­ cross section of n cut ... parameters used [1]: [1] Lakomov I. A., Vechernin V. V. , PoS (Baldin ISHEPP XXI) 072 (2012) 4 Regge-Gribov multipomeron approach Mean and variance of the number of pomerons: Variance Mean 5 Description of multiplicity Probability for n strings to give N ch ... Possible solution ­ string interactions. ...

Еще в разделе: (Показать все результаты (>206) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2013/QFTHEP13_Keaveney.pdf
• http://qfthep.sinp.msu.ru/talks2011/malyshev_drell-yan.pdf
• http://qfthep.sinp.msu.ru/talks2015/1435513529_malyshev_Higgs.pdf

CompHEP Fortran output is used to compile the squared matrix element for subsequent evaluation of cross sections and distributions. ... FUNCTION LENR() . returns 8 in the case when CompHEP produces a code with Real*8 (DOUBLE PRECISION) floating arithmetics or 16 in the case when CompHEP produces a code with Real*16 (QUADRUPLE PRECISION) floating arithmetics. ... returns a number of incoming particles. ... CHARACTER*6 FUNCTION PINF(NSUB,NPRTCL) . ... REAL*8 FUNCTION SQME(NSUB) . ...

Еще в разделе: (Показать все результаты (>1426) - theory.sinp.msu.ru/ )

• CTEQ4m distribution functions
• Main facilities
• Simplifying the expression for vertices

... The importance of gas-solid chromatography as a source of additional data for the positive structural elucidation of novel isomers by gas chromatography/mass spectrometry is discussed. ... The molecular models required for these calculations were constructed using a conventional approach and molecular mechanics; the corresponding results obtained are compared. The order of separation predicted by molecular mechanics appeared close to that observed experimentally. ...

Еще в разделе: (Показать все результаты (>1211) - chem.msu.ru/ )

• Comparative Analysis of Intramolecular Parameters of Nitrocompounds:
• Moscow University Chemistry Bulletin Vol. 50, No. 4, P. 238 (2009)
• Optimization of Optical Scheme Parameters in Dual-Beam Thermal Lens...

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>20) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search