... Поиск по МГУ | Лента новостей | ... О проекте . ... Please, enter the code that you see below in the input field. This is for blocking bots that try to post this form automatically. If the code is hard to read, then just try to guess it right. If you enter the wrong code, a new image is created and you get another chance to enter it right. ... 2003 2011 MsuNews.Ru Новости МГУ . 2003 2011 Разработка и дизайн MMForce.Net . ... Экспорт новостей (RSS) ...

Еще в разделе: (Показать все результаты (>40) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ
• MsuNews.Ru | Блог проекта
• MsuNews.Ru | Энциклопедия

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

The laboratory runs currently several scientific projects aimed at the foundations of quantum information science (the theories of quantum measurement and entanglement, design and analysis of quantum cryptographic protocols, atoms dynamics in optical dipole trap, etc.), applications of quantum theory to modeling quantum interference phenomena in multilevel atoms interacting with optical and magnetic fields (dark resonance spectroscopy), and exploring ... Physics 96 (4), 629-642 (2003). ...

Еще в разделе: (Показать все результаты (>76) - qilab.phys.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>45) - lav01.sinp.msu.ru/ )

• Vladimir L. Korotkikh

List of available DNA-protein and RNA-protein complexes . List of Pfam domains presented in DNA-protein and RNA-protein complexes . List of SCOP domains presented in DNA-protein and RNA-protein complexes . ... Amino acid code changer : 3-letter code to 1-letter code and vice versa . The work is supported by the Russian Foundation of Basic Research, grants 06-07-89143 and 06-04-49558, and INTAS, grant 05-1000008-8028 ...

Еще в разделе: (Показать все результаты (>3739) - monkey.belozersky.msu.ru/ )

• About this project
• Search for potential hydrogen bonds between protein and nucleic acid
• DNA/RNA-Protein structures

Title Author Key words Review of the monograph Yu.G. Volkova "Creativity: creativity against imitation" Dmitriev A.V. creative class, creativity, creative, imitation This article is reviewed monograph Yu.G. Volkova "Creativity: creativity against imitation" (2013). ...

Еще в разделе: (Показать все результаты (>29) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/documents/umo/bologne/MAASTR~1.PDF
• http://www.socio.msu.ru/vestnik/archive/2011/2/05.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/2/11.pdf

... Главная Факультет политологии Новости факультета Новость . ... На заседании Ученого совета факультета политологии МГУ состоялось торжественное вручение сертификата призеру международного конкурса эссе на английском языке ?Creating the Future We Want?. Декан факультета политологии профессор А. Ю. Шутов поздравил студента III курса Павла Воробьева и вручил ему от имени организаторов конкурса сертификат за глубокое понимание и раскрытие темы. ... Поступление на факультет политологии в 2016 году . ...

Еще в разделе: (Показать все результаты (>15) - polit.msu.ru/ )

• Новости факультета

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Higher School of Management and Innovation (Faculty of Lomonosov MSU) was founded in June 2006 by the Academic Council on the initiative of the Moscow State University Rector, academician V.A. Sadovnichiy and Chairman of the Board of Directors of JSFC "Sistema" V.P. Yevtushenko. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• MSU Higher school of management and innovation |
• Application for participation | MSU Higher school of management and innovation
• Contact information | MSU Higher school of management and innovation

Psychology in Russia: State of the Art Volume 6, Issue 1, 2013 Russian Psychological Society Lomonosov Moscow State University The role of television in cultivating the values of pluralism and cultural diversity in children Anna A. Gladkova Lomonosov Moscow State University, Moscow, Russia This article examines the influence of the mass media and in particular television on the development of the values of pluralism and cultural diversity in children. ... Television & the Cultivation of Values. ...

Еще в разделе: (Показать все результаты (>165) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/people/nurkova/nurkova2004b.pdf
• http://www.psy.msu.ru/science/psyrussia/2013/frolova.pdf
• http://www.psy.msu.ru/science/psyrussia/2013-2/kaczmarek_2013_2.pdf

... ECOLOGICAL COOPERATION" . ... Brjanskaja oblast, Dubrovskij rajon, Seshcha (village), School . Brjanskaja oblast, Djat'kovskij rajon, Bytosh (village), School . ... Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Borodino (village), School . Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Yardenikha (village), School . ... Moscow, Children's Ecological Center of the National Park "Losinyj Ostrov" - the coordinator of ecological work of 18 Korolev-town's schools . Moscow, School #222 . ...

Еще в разделе: (Показать все результаты (>29) - www.ecocoop.ru/ )

Host: localhost Database: atomax2 --------------------------------------------------------- -- Server version 3.23.52-nt -- -- Table structure for table ' deliveries ' -- DROP TABLE IF EXISTS deliveries ; CREATE TABLE deliveries ( id_delivery int (11) NOT NULL auto_increment, subj varchar( 255 ) default NULL , author varchar( 255 ) default NULL , type tinyint (4) default ...

Еще в разделе: (Показать все результаты (>85) - textbook.sinp.msu.ru/ )

• SPAW Editor documentation
• Index of /modules/ax_content/atomax/spaw/lib/themes/default/img
• Index of /modules/ax_content/atomax/spaw/lib/themes/classic/img

... Форумы > Обсуждение сайта > Тема . Автор темы Алексей Ремизов . Форумы Список тем Новая тема . ... почта не работает! ... Вчера посылал вам письма по адресу administrator@mmonline.ru, . но у вас почта не работает! ... This message was created automatically by mail delivery software. A message that you sent could not be delivered to one or more of its . ... Ответить Цитировать . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>271) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное | Работа в Microsoft
• MMOnline | Форумы | Аспирантура
• MMOnline | Форумы | Разное

Academic English English for Students of Mathematics and Mechanics Supplementary Exercises Part II L.N.Vygonskaya O.Y.Sviridenko MSU Moscow 2012 Academic English (part 2 of 4) The tasks are based on «English for Students of Mathematics and Mechanics» by Y.I. Mindeli. Unit 1 Task 18. ... 1 Armer, T. Cambridge English for Scientists, Cambridge, 2011 4 Academic English (part 2 of 4) Unit 7 Midterm test Unit 8 (At home) Make up a list of linking words you know and bring it to class. ... Task 15 p.93. ...

Еще в разделе: (Показать все результаты (>24) - www.eng.math.msu.su/ )

... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...

Еще в разделе: (Показать все результаты (>6) - depository.msu.ru/ )

• Biological information | depozitariy
• Main grant | depozitariy

Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... Scientific Research Training . ... We?ll tell you what you need to know about the Festival of Science. ... What is the Festival of Science, and why is it so attractive to all who have participated in it?both children and adults?that they look forward eagerly to each new Festival? ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>5) - pk.math.msu.ru/ )

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>12) - tex.bog.msu.ru/ )

• http://tex.bog.msu.ru/rustexeo.html
• http://tex.bog.msu.ru/numtask/unnu12.pdf

... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...

Еще в разделе: (Показать все результаты (>11) - psyberlink.flogiston.ru/ )

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>173) - www.pereplet.ru/ )

... The main interest of researchers was focused on TiO2:Co and TiO2:V thin films, that reveal an essential difference in their behavior: TiO2:Co films demonstrate either strong magnetization, MO response or AHE independently on presence or absence of magnetic Co clusters inside the films. ... It has been found that: thin films TiO2:Co(0.5%, 1.3% and 5%) have either magnetization or MO signal of Transversal Kerr effect with the absence of magnetic clusters. ...

Еще в разделе: (Показать все результаты (>10) - magn.phys.msu.ru/ )

• Название сайта

... Заведующий кафедрой: . ... доцента кафедры оптики, спектроскопии и физики наносистем . ... старшего научного сотрудника кафедры оптики, спектроскопии и физики наносистем . ... конкурса молодых научных сотрудников МГУ 2015 г. старшего научного сотрудника кафедры оптики, спектроскопии и физики наносистем . ... Читать далее . ... Во второй рассказывается про одну из научных баз кафедры оптики, спектроскопии и физики наносистем ? ... Кафедра оптики, спектроскопии и физики наносистем 1940 - 2016. ...

Еще в разделе: (Показать все результаты (>5) - optics.phys.msu.ru/ )

• Chair of optics, spectroscopy and nanosystems physics
• May 2015 ? Chair of optics, spectroscopy and nanosystems physics
• azotov ? Chair of optics, spectroscopy and nanosystems physics