... Working channel dimensions: length - 1200 mm, width - 300 mm, height - 30 mm; 50mm. Air velocity range in a working channel: 5-120 m/s with a step 0,1 m/s. Mass air rate: 0,2-1,3 kg/s . ... Model/flow temperature difference: up to 120C . ... Aerodynamic unit 'SAU-Siemens' was created to investigate heat exchange intensification on the surfaces with complex relief (dimples, grooves, etc) in flat channels at subsonic flow of working medium (air). ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>2) - termogaz.imec.msu.ru/ )

• aboutLab

e-mail: natalia.petrashkova@gmail.com) , , national identity, immigrants, France , . ... The comers from the other side of the Mediterranean created within French society an Islamic identity that became a part of the country's political and social specificity. The article covers the problem of identity in modern France and transformation of public opinion about who is to be considered French. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>46) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2013/2/05.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/2/06.pdf
• http://www.socio.msu.ru/vestnik/archive/2014/1/13.pdf

Chemistry of Heterocyclic Compounds, Vol. ... 8, 1995 INSTRUCTIONAL TECHNIQUE IN HETEROCYCLIC CHEMISTRY COMPUTER ANIMATION: A NEW METHOD AND REPRESENTATION IN HETEROCYCLIC FOR TEACHING, OF KNOWLEDGE COMMUNICATION, ABOUT REACTIONS CHEMISTRY E. V. Babaev We propose the use of computer animation techniques .for representation of knowledge about organic reactions, in particular as applied to syntheses and transformations of heterocTcles. ... Let us briefly consider the capabilities of this program. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>122) - www.chem.msu.ru/ )

• Dmitriy Mendeleev Online

... Alexei Lidov.. ... The creation of sacred space as a form of creativity and subject of cultural history .. ... 91 Mikhail V. Bibikov Byzantine Eden: "time in space" .. ... 140 Svetlana Popovi The Byzantine Monastery: its Spatial Iconography and the Question of Sacredness .. ... 525 762 Milena Rozhdestvenskaya The Creation of Sacred Space in Medieval Russian Literature: apocrypha and chronicles .. ... 556 Vladimir V. Sedov The Sacred Space of the Medieval Russian Church: the Architectural Aspect .. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>23) - imk.msu.ru/ )

• Èíñòèòóò ìèðîâîé êóëüòóðû ÌÃÓ

... Ìàãèñòåðñêîå îáðàçîâàíèå . ... Enterprise Information Infrastructure . This course is focused on enterprise infrastructure and integration technology. Course presents different approaches to enterprise architecture and modern solutions of information infrastructure problems. Course?s topics cover strategies that help large enterprises to increase the agility of their IT systems. ... Enterprise portal technology, including collaboration and knowledge management . ... FI- Master data . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>19) - hcs.cmc.msu.ru/ )

• Master program "Open Information Systems" | Ìàãèñòåðñêîå è ïîñëåâóçîâñêîå

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>5) - tex.bog.msu.ru/ )

• http://tex.bog.msu.ru/rustexeo.html

... Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. We have grown up in the laboratory of laser spectroscopy of water media. ... Use of such powerful modern tools of solution of inverse problems and problems of optimization provides successful solution of a wide range of applied problems of diagnostics and analysis of water media. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>29) - rswater.phys.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Vorontchuk, Cox III R.W. Developing a Competency-based Career Training and Professional Development Program for Latvia INTRODUCTION. ... With the support of a grant from the NISPAcee a team from the Latvian School of Public Administration, the University of Latvia and the University of Akron (Ohio, USA) prepared for the Chancellery of Latvia a proposal for the creation of a career-long professional development program for those in the civil service. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>8) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./leigh.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>115) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf
• http://fgp.msu.ru/wp-content/uploads/2013/12/Luce_Moscow_2013_small.pdf

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ THE NEW GRIDDED KURIL-KAMCHATKA BATHYMETRY FOR TSUNAMI MODELING An. ... For calculations in each grid point where the depth is to be found the algorithm uses up to 9 points from data source. ... Then the spline interpolation is used for defining the depth value in the grid-point. ... Hydrographic Survey Data, CD-ROM data set, Ver. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>22) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E09_Karlik.pdf

Cassa depositi e prestiti spa Long-Term Instruments for financing Infrastructure Franco Bassanini Chairman of Cassa Depositi e Prestiti Institute of the Russian Academy of Sciences September 22, 2010, Moscow Cassa depositi e prestiti spa Global capitalism and short-termism · The short-termism that characterized recent global capitalism had negative effects on the ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>19) - www.mse-msu.ru/ )

... x25BA; Login to the site . Skip to create new account . Login here using your username and password . ... Username . Password . ... Some courses may allow guest access . ... For full access to courses you'll need to take a minute to create a new account for yourself on this web site. ... You can now access the full course. From now on you will only need to enter your personal username and password (in the form on this page) to log in and access any course you have enrolled in. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>10567) - moodle.ffl.msu.ru/ )

... News . For 1st and 2nd-year students . Introduction to quantum physics . ... About us . ... Create new account (active tab) . ... Request new password . E-mail * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. Create new account . ... 2003 2016 Department of Quantum Electronics . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>4) - quantum.phys.msu.ru/ )

... x25BA; Login to the site . Skip to create new account . Login here using your username and password . ... Username . Password . ... Some courses may allow guest access . ... For full access to courses you'll need to take a minute to create a new account for yourself on this web site. ... You can now access the full course. From now on you will only need to enter your personal username and password (in the form on this page) to log in and access any course you have enrolled in. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>3) - www.kids.genebee.msu.ru/ )

... Èííîâàöèîííàÿ . ñòðóêòóðà ÌÃÓ . ... äåÿòåëüíîñòè . ... Process of Forming a Company . ... Finance for Start-Up . ... This guide primarily deals with the issues relevant to the conception and creation stages of development, and much less with the implementation stage. ... Most importantly, the material on Start-Up Company Development is presented to help your start-up succeed. ... 2005 Óïðàâëåíèå èííîâàöèîííîé ïîëèòèêè . è îðãàíèçàöèè èííîâàöèîííîé äåÿòåëüíîñòè . ÌÃÓ èì. Ì.Â. Ëîìîíîñîâà . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>29) - innovation.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>13) - mouse.genebee.msu.ru/ )

MEIS : ­ 2007 ­ 3/802 537.9 538.975 P.N.Chernykh, G.A Iferov., ... S. Abo, S. Ichihara, T. Lohner, F. Wakaya, T. Eimori, Y. Inoue, M. Takai, Nuclear Instruments and Methods in Physics Research B237 (2005) 72. ... D.P.Woodruff, Nuclear Instr. and Methods in Phys. Research B256 (2007) 293. ... T.Gustafsson, H.C. Lu, B. W. Busch, W. H. Schulte, E. Garfunkel, Nuclear Instr. and Methods in Physics Research B183 (2001) 146. ... L.R. Doolittle, Nuclear Instr. and Methods in Physics Research B9 (1985) 344. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>78) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Seminars_Pdf-filesPresentations/Chechenin_Presentation_14-01-16.pdf
• http://danp.sinp.msu.ru/Seminars_Pdf-filesPresentations/Chechenin_Presentation_5-02-15.pdf

... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...

160. Project description | Siberian Lang