... Study of the Russian " Silver Age " neology . ... Dictionaries of neologisms constitute an important part of lexicography. ... The peculiarity of our project is the full scope of text (at least published) considered and uniformity of description: dictionary entries of all the authors’ neologisms have the same format (suggested for Khlebnikov’s neology). ... Khlebnikov's neology (N. N. Pertsova). In 1995 "The Dictionary of Khlebnikov's Neologisms" was published. ...

Еще в разделе: (Показать все результаты (>11) - lcl.srcc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• ConClus

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>14) - www.msm.biophys.msu.ru/ )

Home . Data . ... Meteor-M тДЦ1 . ... Meteor-M тДЦ2 . ... Solar energetic particles . ... Solar flare database (RU) . ... Space Monitoring Data Center of SINP MSU (SMDC) collects the data of space experiments as well as scientific and applied models for studying the geomagnetic and radiation conditions in the near-EarthтАЩs space environment. ... Latest data from featured spacecrafts . Meteor-M #1 is alive! ... Space weather now . ... NOAA N3KL Solar Activity Monitor . ... Developed in 2007. ...

Еще в разделе: (Показать все результаты (>7) - smdc.sinp.msu.ru/ )

... IPI-1D is a set of programs for processing and interpretation of VES data within the framework of horizontally layered models . ... Except programs already listed above, our specialists developed some programs for modeling, studying, visualization and interpretation of resistivity data in anisotropic media (anisotropic halfspace, horizontally layered media with anisotropic basement and vertical contact of two anisotropic media). ...

Еще в разделе: (Показать все результаты (>34) - geophys.geol.msu.ru/ )

... Добавить новое сообщение . ... Цефтибутен (n-702) . ... Таким образом, представленные данные характеризуют цефтибутен как перспективный оральный цефалоспорин III поколения, обладающий высокой антимикробной активностью, отличной клинической эффективностью, хорошей переносимостью. Основными показаниями к назначению ЦБ являются инфекции мочевыводящих путей, верхних и нижних отделов дыхательного тракта. Препарат хорошо зарекомендовал себя при лечении кишечных инфекций в детской практике. ...

Еще в разделе: (Показать все результаты (>213) - www.nature.web.ru/ )

• Факторы роста и их роль в регуляции репродуктивной функции у больных с

... Publications . ... Number of publications 0 . ... Borisov A. V. , Kazakov A. O. , Kuznetsov S. P. Nonlinear dynamics of the rattleback: a nonholonomic model . ... A number of strange attractors are considered, for which phase portraits, Lyapunov exponents, and Fourier spectra are presented. ... Borisov A. V., Kazakov A. O., Kuznetsov S. P., Nonlinear dynamics of the rattleback: a nonholonomic model , Physics-Uspekhi, 2014, vol. 184, no. 5, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 ....

Еще в разделе: (Показать все результаты (>53) - ics.org.ru/ )

... About Space Monitoring Laboratory, scientific directions, instruments, contacts . ... В XXI веке в оптической астрономии появился новый мощный инструмент исследования Вселенной - синоптические обзоры или синоптические телескопы. ... Но если иметь в виду астрофизический объект вам обязательно понадобится спектральный телескоп, чтобы понять его физическую природу или установить его подтип. ... В основном спектральные телескопы имеют диаметры до 2-3 метров (таких телескопов в мире более 50). ... МАСТЕР...

Еще в разделе: (Показать все результаты (>9) - master.sai.msu.ru/ )

• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...

Еще в разделе: (Показать все результаты (>3) - phys.web.ru/ )

QUANTUM STOCHASTIC PROCESSES This course is for 4-5th year and graduate students. ... It is dedicated to systematic account of Quantum Stochastic Processes right in the form they are actually used in theoretical calculations of Quantum Open Systems. ... LECTURE 2. ... Open systems and quantum stochastic processes. Mathematical definition of an open system and quantum stochastic process. ... Markovian quantum stochastic processes. Formal definition of quantum markovian stochastic process. ...

Еще в разделе: (Показать все результаты (>42) - qilab.phys.msu.ru/ )

• Quantum Information Lab, Int'l Laser Ctr. and Faculty of Physics, M.V.Lomonosov

1, 120102 (2012) 2D- - . ... 2D- - E-mail: kozlov@polly.phys.msu.ru 2012 120102-1 [4, 7], . ... 2D- - 1, 120102 (2012) 1D- , x n+1 . ... 5: (), ( ) P () a = 1.9 = 0.1 t = 10000 . ... 2] Kaneko K. Chaos. ... E-mail: kozlov@pol ly.phys.msu.ru In the field of synchronization processes coupled map lattices (CML) represent paradigmatic models of extended systems exhibiting spatiotemporal chaos, self-organization and synchronization due to the rich variety of global qualitative behavior. ... 2012 120102-8 ...

Еще в разделе: (Показать все результаты (>3) - uzmu.phys.msu.ru/ )

• http://uzmu.phys.msu.ru/issue/120103.pdf

Solar proton anisotropy and dropout effects in the polar cap and auroral zone during period of the extended substorm activity Kuznetsov S.N., and Lazutin L.L. Institute of Nuclear Physics, Moscow State University, Vorob'evy gory, Moscow, 119899 Russia Abstract. ... Dropout effects of the proton radial distribution were found suggesting specific field line stretching inside the magneosphere trapping region during period of extended substorm activity. ... Fig 1. ...

Еще в разделе: (Показать все результаты (>58) - www.kosmofizika.ru/ )

• http://www.kosmofizika.ru/pdf2/e_p_apatity08.pdf
• http://www.kosmofizika.ru/pdf2/ap_seminar06.pdf
• http://www.kosmofizika.ru/pdf1/abel_02b.pdf

ЭЛЕКТРОСТАТИЧЕСКИЕ СВОЙСТВА ПРОМОТОРНЫХ ПОСЛЕДОВАТЕЛЬНОСТЕЙ E.COLI И РАННИХ ОБЛАСТЕЙ ГЕНОМОВ ФАГОВ Т4 И Т7 . ... Рассчитан профиль распределения электростатического потенциала вокруг полной последовательности хромосомы E.coli, а также 359 фрагментов ДНК длиной 400п.н., содер-жащих промоторы E.coli, обозначенные на хромосоме как экспериментально подтвержденные, и промоторы ранних генов фагов Т7 и Т4. Проведен анализ особенностей электро-статических свойств промоторных и непромоторных областей ДНК. ...

Еще в разделе: (Показать все результаты (>9) - www.library.biophys.msu.ru/ )

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>3) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>3) - iconolat13.phys.msu.ru/ )

• Program overview

The Department of Talented Youth Affairs and Professional Orientation . ... Law graduates turned in a good performance in the competition ?Foreign Direct Investment Arbitration Moot? ... November 30, 2015, an interactive roundtable meeting on ?Problems of continuous psychological and educational support of gifted children: domestic and foreign experience? was held. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>15) - talant.msu.ru/ )

• MSU CNIR visited the Republic of Korea in the delegation of ?Sport
• editor | The Department of Talented Youth Affairs and Professional Orientation
• Law graduates turned in a good performance in the competition ?Foreign Direct

... N 3 Contents Anthropology Goodkova L.K. The value of works of Y.Y. Roginsky for the development of physiological anthropology (p. 4-9) The works of Y.Y. Roginsky on variability, correlation and integrity were of great importance for the development of physiological, ecological, anthropology. ... Race of the child is also mentioned as a possible factor. Y. Roginsky was particularly interested in age changes of different anthropometric and anthroposcopic traits in children of different ethnicities. ...

Еще в разделе: (Показать все результаты (>20) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2013_2.doc
• http://www.antropos.msu.ru/vestnic/e2015_1.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>4) - ani.cmc.msu.ru/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU
• Department of the Automation for Scientific Research CMC MSU | Computational

... Text as Means of Cultural Exchange . Contents . Abstracts . ... Everyday Life as Text, American and Russian . ... American and Russian Experience in Cultural Myth-Making . ... Nation as Narration: Russian and American Experience . ... Culturally Constructed History . ... Summer School 2016 . Summer School Archives . ...

Еще в разделе: (Показать все результаты (>5) - discours.philol.msu.ru/ )

• Summer School Archives

... List of all selected researchers by country of host institution (in alphabetical order within each country group): http :// erc.europa.eu / pdf / ERC _StG2010Results_All_by_Country. pdf Lists of selected researchers by domain (in alphabetical order): Social Sciences and Humanities: http :// erc.europa.eu / pdf / ERC _StG2010Results_SH. pdf Life Sciences: http :// erc.europa.eu / pdf / ERC _StG2010Results_LS ... Calls for proposals: published annually in summer with deadlines in autumn. ...

Еще в разделе: (Показать все результаты (>23) - ideas.msu.ru/ )