News of PARALLEL.RU par-news на mail.parallel.ru . Вт Авг 11 11:54:19 MSD 2009 . Следующее сообщение: PARALLEL.RU - Новости, специальный выпуск [21/08/2009] . ... Выпуск 269 . 11 августа 2009 г. ------------- Д.Медведев: Россия будет вкладывать средства в суперкомпьютеры. http ://top.rbc.ru/society/28/07/ 2009 /318377.shtml ------------- Опубликована предварительная научная Программа Всероссийской суперкомпьютерной конференции Научный ... Подробная информация о списке рассылки par-news . ...

Еще в разделе: (Показать все результаты (>148) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #266 [27/05/2009]
• PARALLEL.RU - Новости, выпуск #282 [02/03/2010]
• PARALLEL.RU - Новости, выпуск #298 [23/11/2010]

... Snecma Moteurs (Groupe Snecma, France) . ... The Colloquium-458, organized by EUROMECH , will take place at Institute of Mechanics of Lomonosov Moscow State University (MSU) . ... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... France. ... S.-Petersburg State Techn. ...

Еще в разделе: (Показать все результаты (>3) - www.imec.msu.ru/ )

• "Advanced Methods in Validation and Identification of Nonlinear Constitutive

... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... T he goal of this Master Degree program is to educate specialists with the knowledge of the newest technologies of geological study, modeling and development of deposits, advanced scientific methods of seismic and geophysical exploration, geophysical well-logging, production enhancement, etc. ...

Еще в разделе: (Показать все результаты (>5) - www.hsib.msu.ru/ )

• Master Degree in Chemistry | Высшая школа инновационного бизнеса МГУ

. Russian . English .

Еще в разделе: (Показать все результаты (>118) - selena.sai.msu.ru/ )

• Vladislav V. Shevchenko
• Anatoly N. Sanovich
• Problem 2000

Current Issue About us Editors Board of Editors Guidelines Contacts . ... 2015 . ... Nikolaenko V.S. Risk Management in IT-projects . Petrova E.A., Shevandrin A.V., Kalinina V.V. Formation of Efficiency Assessment System for Territorial Administration . ... Legal and political aspects of public administration . Budaev A.V. Light and Dark Sides of Chinas's 'Soft Power' . ... Communication management and strategic communication in public administration . ... Innovations management . ...

Еще в разделе: (Показать все результаты (>329) - ee-journal.spa.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

... Grant of the Russian Foundation for Basic Research (RFBR) No. 16-32-00882 for 2016-2017 "The creation of fluorescent biomarkers on the basis of nanodiamonds and optimization of their properties for targeted delivery of drugs and monitoring their excretion" (headed by K. A. Laptinskiy) . ... Grant of the Russian Foundation for Basic Research (RFBR) No. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>40) - rswater.phys.msu.ru/ )

• Group of laser spectroscopy of solutions of supramolecular compounds and
• Лаборатория лазерной спектроскопии растворов супрамолекулярных соединений и
• Tatiana Dolenko

... I.A. Kurova . ... The research is mainly devoted to the problems of generation, recombination and trapping of nonequilibrium carriers in amorphous hydrogenated semiconductors (a-Si:H, a-Ge:H, a-SiGe:H) and generation and relaxation of metastable states in these materials. ... Light-induced metastable states in undoped, doped and compensated a-Si:H films were studied in a wide temperature range. ... Effect of annealing on the photoelectric properties of boron-doped a-Si:H films. ...

Еще в разделе: (Показать все результаты (>65) - scon155.phys.msu.su/ )

• First-principles calculations of physical properties of crystals
• Theory of electronic properties of disordered semiconductors and systems with
• Physics of Semiconductors division: List of courses

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... First Time"=dword:00000000 "Test Decomp"=dword:00000000 "Test Read"=dword:00000000 "Test Blit"=dword:00000000 "Unique System ID"="BCW" . ... Show Intro"=dword:00000001 . ...

Еще в разделе: (Показать все результаты (>8110) - www.snto-msu.net/ )

• Продам computer без блока питания и HDD - Public forum of MSU united student
• The Windows product key installed on this computer is not genuine - Public
• For sale: AMD AM2 4000+ based computer + Asus flat display 22" - Public forum

Curriculum Vitae . ... Lomonosov Moscow State University , Faculty of Computational Mathematics and Cybernetics . ... Lomonosov Moscow State University , Faculty of Physics . ... 2010 - till now . ... Research Scholar . ... Scholarship supporting perspective young scientists and teachers of Lomonosov Moscow State University who achieved significant results in teaching and research . ... Kurchatov Scholarship for excellent students of the Faculty of Physics, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>12) - oc.cs.msu.ru/ )

• СПИСОК ПУБЛИКАЦИЙ Ровенской Е.А.

... This book contains scientific papers prepared by researchers of Moscow State University and Autonomous University of Puebla in accordance with a special Russian--Mexican scientific program. ... Institute of Mathematical Studies of Complex Systems, Moscow State University . ... Institute of Nuclear Physics, Moscow State University . ... The book is edited by Rector of Moscow State University Dr. V.A. Sadovnichii and Rector of Autonomous University of Puebla Dr. E. Doger Guerero. ...

Еще в разделе: (Показать все результаты (>247) - num-anal.srcc.msu.ru/ )

• Параллельные программы. ЛИТЕРАТУРА
• Аннотированный перечень сокращений
• Наречные обороты

: .. , . . , . - ( ) ( e-mail: kazakova.a.u.@yandex.ru) , , , , modern city, the slums, the marginalized, methodical and methodological problems , . : ; ; - , ; . This article is devoted to methodically important problem of the poll among few cathegories of marginal stratas, mainly to inhabitants of urban slums. Some thypical for underclass research problems are examining, namely: the data verification, the inhabitants accessibility, the communicative barriers and the slective methods.

Еще в разделе: (Показать все результаты (>97) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2010/2/07.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/4/14.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/4/11.pdf

... Новости . ... Музей . антропологии . ... Вестник МГУ Антропология . ... 26 ноября Музее антропологии открылась этнографическая выставка . ... Антропология" . ... Посмотреть фотографии . ... 2008-2010 Научно-исследовательский институт и Музей антропологии им.Д.Н.Анучина . Копирование материалов web-сайта только с разрешения администрации НИИ и Музея антропологии МГУ! ... При использовании материалов, размещенных на сайте НИИ и Музея антропологии МГУ, ссылка на источник обязательна! ...

Еще в разделе: (Показать все результаты (>27) - www.anthropos.msu.ru/ )

Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>22) - halgebra.math.msu.su/ )

• staff:guterman:conf_rus.html | Кафедра высшей алгебры

... We live in the epoch of modern informational, scientific and intellectual technologies. Modern person, especially young one, cannot imagine life without computers, cellular phones and high-speed Internet. ... History has given a lesson - having splendid science, excellent education and highly organized society, having colossal resources, being a great power, we could not cope with the task - to build a prospering and just society. ... It demonstrates the colossal possibilities of modern science. ...

Еще в разделе: (Показать все результаты (>57) - www.rsr-online.ru/ )

• Structure

Research Group of . BIOCHEMISTRY of FIBRINOLYSIS . ... Aisina Roza Bakirovna . ... Enzymology and biochemistry of plasminogen activators (streptokinase, staphylokinase, urokinase and . ... Aisina R.B., Gaisarjan E.C., Snitko Ya.E., Varfolomeyev S.D. Inhibition by L-lysine of esterase, activator and fibrinolytic activities of plasminogen-streptokinase activator complex. ... Jitkova Yu.V., Aisina R.B., Varfolomeyev S.D. Kinetics of fibrinolysis by plasmin: inhibition by fibrin degradation products. ...

Еще в разделе: (Показать все результаты (>152) - www.enzyme.chem.msu.ru/ )

• Research

... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Вакансии . ... Responsible for research and development of Computational Electromagnetics and related areas. ... Complete the project using established processes and procedures. Work closely with the project lead, scientists, software engineers, and project manager; Требования: . Ph.D. degree in Physics, Applied Mathematics or related field / equivalent experience. ...

Еще в разделе: (Показать все результаты (>209) - www.physcareer.ru/ )

• Более 100 вакансий от компании Samsung / Вакансии / Physcareer.ru
• SOFTWARE ARCHITECT / Вакансии / Physcareer.ru
• Solution Centre Engineer (Graduate) / Вакансии / Physcareer.ru