University Satellites and . Space Science Education . ... The project of the scientific - educational small satellite for research of Earth upper atmosphere density . ... At the end of 80th years in Kuybishev aviation institute (nowadays the Samara State Aerospace University) has been developed the project of small spherical satellite " PION ", intended as for a calibration of ground resources of tracing behind space objects, and for refinement of density of upper atmosphere of the Earth. ...

Еще в разделе: (Показать все результаты (>99) - cosmos.msu.ru/ )

Currently available grants . Exchanges and Training Programs for the NIS . ... The U.S. Department of State's Bureau of Educational and Cultural Affairs (ECA), Office of Citizen Exchanges, is offering a grant opportunity for U.S. organizations to conduct exchanges and training programs in collaboration with partner organizations for the New Independent States. ... Funded by the U.S. Department of State, Program for Research and Training on Eastern Europe and the Newly Independent States. ...

Еще в разделе: (Показать все результаты (>22) - suny.msu.ru/ )

• Center on Russia and the United States :: Contacts
• Центр по делам России и США :: Публикации

... Lomonosov Moscow State University . ... Home About Communication and Information Department . ... Our main areas of expertise are information exchange, building network partnerships, development of complex internet applications and solutions, implementing e-learning practices.б  . ... Dr. of Science (biology) Alexander O. Makeev Graduated from Geographic Faculty of Lomonosov Moscow State University. ... Alexander Ladygin graduated from department of Biology of Lomonosov Moscow State University. ...

Еще в разделе: (Показать все результаты (>30) - ecfs.msu.ru/ )

• About Eurasian Center for Food Security | ECFS
• Online Consultation on Network and Partnerships in the area of Food Security |
• Topic 1: Building the Eurasian Food Security Network / Создание Евразийской

V. V. KOZLOV Department of Mechanics and Mathematics Moscow State University, Vorob'ievy Gory 119899, Moscow, Russia ON JUSTIFICATION OF GIBBS DISTRIBUTION Received January 10, 2001 DOI: 10.1070/RD2002v007n01ABEH000190 The paper develop a new approach to the justification of Gibbs canonical distribution for Hamiltonian systems with finite number of degrees of freedom. It uses the condition of nonintegrability of the ensemble of weak interacting Hamiltonian systems. ... Energy h is non-negative. ...

Еще в разделе: (Показать все результаты (>109) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/ecf/PHDK32.pdf
• http://ics.org.ru/upload/iblock/250/188-an-extended-hamilton-jacobi-method_ru.pdf
• http://ics.org.ru/upload/iblock/efa/rm_70_1167.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Seminar archive . ... Type Ia Supernovae (SNe Ia) have an important role to measure a distance to an anonymous galaxy because they have a good correlation of the decline rates of the light curves with the absolute luminosity. ... First, super-Chandrasekhar SNe which have extremely high luminosity, slow decline rate of the light curves, slow expansion velocity and strong carbon features. ... As another example of diversity of SNe Ia, I would like also to introduce Type Iax SNe. ... All seminars: . ...

Еще в разделе: (Показать все результаты (>22) - master.sai.msu.ru/ )

• SAI Space Monitoring Laboratory

... The Symposium's three breakout sessions focused on risks from different perspectives: enterprise use, resource constrained environments, and combating malicious use. ... Specifically, a DNS collaborative response, awareness, technical training, and future DNS security, stability, and resiliency collaboration should take precedence within the issues selected for further study and implementation. ... Breakout Session Overview.. ... 30 Appendix F: Combating Malicious Use Breakout Session Guide Book .. ...

Еще в разделе: (Показать все результаты (>18) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/perl.doc

... Let us recall the principle of correlation of maxima and the method of dating of Suppose that a historical period from the year A to the year B in the events based on it. history of a region G ( i.e ., a state, a city, etc.) has been described in a fairly comprehensive year-by-year text (chronicles, annals, etc.), i.e ., the text X is split into sections or chapters X(T), each of which describes the events of one year T. We calculate the ... Let us briefly describe this measure. ...

Еще в разделе: (Показать все результаты (>85) - hbar.phys.msu.ru/ )

• http://hbar.phys.msu.ru/gorm/fomenko/fomenko5.pdf
• http://hbar.phys.msu.ru/gorm/ahist/antikythera1.pdf
• http://hbar.phys.msu.ru/gorm/fomenko/fomenko2.pdf

... Issues of the year 2010 . ... Instructions for Authors . ... The scientific English language journal ‘GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY’ aims at informing and covering the results of research and global achievements in the sphere of geography, environmental conservation and sustainable development in the changing world. ... In the text the surname of the author and the year of publication of the reference should be given in square brackets, i.e. [Author1, Author2, 2008]. ...

Еще в разделе: (Показать все результаты (>199) - www.geogr.msu.ru/ )

• ПУБЛИКАЦИИ В PEER-REVIEWED OPEN ACCESS JOURNALS OF INTERNATIONAL SCIENTIFIC
• ONLINE-QUESTIONNAIRE OPEN ACCESS PUBLISHING
• louis vuitton replica purse wholesale louis vuitton outlets cheap sales

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>90) - comphep.sinp.msu.ru/ )

• new-mac [CompHEP]
• extra:model:main [CompHEP]
• extra:main [CompHEP]

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cmc.msu.ru ) . ... Alexander Valeryevich POZDNEEV (November 22, 1983, Novosibirsk, Russia) тАФ teaching assistant (assistant professor). Graduated with honours from the Faculty of Computational Mathematics and Cybernetics (CMC) at Lomonosov Moscow State University (MSU) (2006). Succesfully completed postgraduate study at the Faculty of CMC at Lomonosov MSU (2009). ... A.V. Pozdneev. ...

Еще в разделе: (Показать все результаты (>7) - ani.cmc.msu.ru/ )

• Alexander Valeryevich Pozdneev | Department of the Automation for Scientific

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>5) - theorphys.phys.msu.ru/ )

... There are two main thrusts in the theory of regular and chiral p olytop es: the abstract, purely combinatorial asp ect, and the geometric one of realizations. ... The dimension of a faithful realization of a finite abstract regular p olytop e in some euclidean space is no smaller than its rank, while that of a chiral p olytop e must strictly exceed the rank. ... In E4 , therefore, the open cases are the (finite) chiral polytopes of rank 3, and the regular or chiral apeirotopes of ranks 3 and 4. ...

Еще в разделе: (Показать все результаты (>38) - dfgm.math.msu.su/ )

• http://dfgm.math.msu.su/files/0articles/Zheglov/GTM.pdf
• http://dfgm.math.msu.su/files/koudr/publ.pdf
• http://dfgm.math.msu.su/files/0articles/Ilyutko/ilyutko-JKTR.pdf

... 2 What is MATLAB ?? Basic Matrix Operations Script Files and M-files Some more Operations and Functions APPLICATIONS: Plotting functions .. ... Vectors are special forms of matrices and contain only one row OR one column. Scalars are matrices with only one row AND one column MATLAB Matrices 17 A matrix with only one row AND one column is a scalar. A scalar can be created in MATLAB as follows: » a_value=23 a_value = 23 MATLAB Matrices 18 A matrix with only one row is called a row vector. ...

Еще в разделе: (Показать все результаты (>9) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2013.PRIA.Mamaev_Lukin_Yurin.HermiteNLM.en.pdf
• http://imaging.cs.msu.ru/pub/2013.PRIA.Levashov_Yurin.RidgeAndTree.en.pdf

... 96-05-65519, отчет за 1997 год) . ... Dynamics of srtike-slip magmatic duplexes . ... During 1997, we conducted (1) field works in the South Ural area (for account of another financial sources), (2) theoretical investigations of the earlier studied strike-slip magmatic duplexes from Central Kazakhstan and the Kola-Karelian region, (3) analitical study of magmatic rocks composition (for account of another financial sources), and (4) development of computer databases and software. ...

Еще в разделе: (Показать все результаты (>10) - sbmg.geol.msu.ru/ )

• Calendar Converter
• Europrobe2

... Announcement of the Availability of the LSI Logic International Services Scholarship to Post-Graduate Students of Moscow State University and Moscow Institute of Physics and Technology . ... Interested applicants should submit the following documents not later than September 26, 2003 : . ... LSI Logic International Services is wholly own subsidiary of LSI Logic Corporation, Milpitas, California. ... LSI is headquartered at 1621 Barber Lane, Milpitas, CA 95035. ... LSI Logic . ...

Еще в разделе: (Показать все результаты (>196) - www.mmonline.ru/ )

• До 1 ноября Springer предоставляет бесплатный доступ к более чем 150
• MMOnline | Аспирантура | Стипендия LSI Logic для аспирантов МГУ
• MMOnline | Новости | Стипендия LSI Logic для аспирантов МГУ

Symbolic circuit-matrix processor and evaluator . ... This software is reliable over the range of benchmark circuit complexity (both *.CIR and *.MAT file). ... SYMBOL is a symbolic-algebra package which in contrast to REDUCE, MACSYMA, MAPLE, MATHEMATICA, MathLAB, MathCAD and other known multi-purpose systems is especially intended for analysis of any lumped, linear, time-invariant circuit. ... pure ASCII text . ... CIRSYM - SYMbolic CIRcuit processor used to format ASCII text file *.out for CALCSYM. ...

Еще в разделе: (Показать все результаты (>13) - astrometric.sai.msu.ru/ )

• Symbolic circuit processor
• Symbolic matrix processor