... Inofficial Mathematical Chemistry page by Eugene V. Babaev Moscow State University, Russia . ... Section 2 recalls several concepts of the graph theory and topology of surfaces, necessary for further discussion, and Section 3 is the overview of the common types of molecular graphs and molecular surfaces used in chemistry. ... The objects are some specific molecules with bipartite graphs (which follow so-called "alternation rule", and the operation is a polar chemical reaction. ... Chemistry . ...

Еще в разделе: (Показать все результаты (>133) - www.chem.msu.ru/ )

• Table of contents

About BAFIZ . BAFIZ at SINP MSU . ... The main aims of the Project at SINP of MSU . ... Development of the Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE) at SINP of MSU . Development of the tools for Space Physics data utilization and processing . ... The communication infrastructure base of the Project at SINP of MSU is based on Radio-MSU Network . The computational base of the Project at SINP of MSU is Computing Center ALPHA . ...

Еще в разделе: (Показать все результаты (>6) - dbserv.sinp.msu.ru/ )

Mathematical modeling of biophysical processes in living cells and tissues . duration 6 months . ... 7(095) 939-26-12, Fax: +7(095)939-31-13, Email: romanov@yumr.phys.msu.ru . ... Interaction of femtosecond laser pulses with plasmas of modified targets . ... Theoretical investigations of polarization self-action and wave-interaction effects in nonlinear optics. ... Alexander V. Priezzhev, Associate Professor, Candidate of Sciences (physics and mathematics), Tel. ...

Еще в разделе: (Показать все результаты (>24) - foroff.phys.msu.ru/ )

• Postdoctoral training of foreign scientists at Physical Department

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Higher School of Management and Innovation (Faculty of Lomonosov MSU) was founded in June 2006 by the Academic Council on the initiative of the Moscow State University Rector, academician V.A. Sadovnichiy and Chairman of the Board of Directors of JSFC "Sistema" V.P. Yevtushenko. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>7) - hsmi.msu.ru/ )

• Project and Process Management | MSU Higher school of management and innovation

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Octotron: Active Control for Reliable Functioning of Supercomputers . ... DiMMon: a New Approach to Supercomputer Monitoring . ... X-COM: Distributed Computing Software . ... We propose a new approach to building distributed modular monitoring system named DiMMon, both for current and future systems, with an extremely high degree of parallelism. ... Research Computing Center (RCC) of Lomonosov Moscow State University...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• MSU SUPERCOMPUTERS: "LOMONOSOV" | Moscow University Supercomputing Center
• Trainings on Application Development and Optimization | Moscow University
• APPLICATIONS: Electronics and Acoustics | Moscow University Supercomputing

QUANTUM STOCHASTIC PROCESSES This course is for 4-5th year and graduate students. ... It is dedicated to systematic account of Quantum Stochastic Processes right in the form they are actually used in theoretical calculations of Quantum Open Systems. ... LECTURE 2. ... Open systems and quantum stochastic processes. Mathematical definition of an open system and quantum stochastic process. ... Markovian quantum stochastic processes. Formal definition of quantum markovian stochastic process. ...

Еще в разделе: (Показать все результаты (>78) - qilab.phys.msu.ru/ )

• Quantum Information Lab, Int'l Laser Ctr. and Faculty of Physics, M.V.Lomonosov

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>5) - www.rlcentre.com/ )

... 3 ­ Sternberg State Astronomical Institute, Moscow, :jeanna@sai.msu.ru The graphic method of the analysis of an arrangement of linear structural elements on geographical and geological maps of continents (A.V.Dolitsky, [1]) has allowed to find out global stress fields of the past and among them one which directions (the main normal and maximal tangents) describe more than 80 % of all linear elements of a relief. ... The found poles share program way on density of an arrangement on 3-4 groups. ...

Еще в разделе: (Показать все результаты (>77) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Shev/Publications/ms38/ms082.pdf
• Родионова Жанна Федоровна
• Aleksei A. Berezhnoi

... Institutes of Chernogolovka . The largest of all the scientific institutions of the center is the Institute of Chemical Physics in Chernogolovka , where fundamental problems of chemical physics are studied: kinetics and mechanisms of chemical and biological processes; processes of combustion, explosion, and polymerization; and mechanisms of elementary reactions involving high energy particles. ... Developments and Technologies . ...

Еще в разделе: (Показать все результаты (>8) - www.issp.ac.ru/ )

• Gavrilov M.G. "Zviozdnyj Mir", vol.IV

... SHORT COMMUNICATIONS HCh: New Potentialities for the Thermodynamic Simulation of Geochemical Systems Offered by Windows Yu. ... Both of these possibilities have already been implemented in the HCh package [1] but 834 HCH: NEW POTENTIALITIES FOR THE THERMODYNAMIC SIMULATION User User's programs 835 Unitherm program Main program Gibbs program Thermodynamic database Working files of the project External modules of the user Fig. ... The third entry point at the user's module is the main ("working"). ...

Еще в разделе: (Показать все результаты (>74) - www.geol.msu.ru/ )

• Links of engineering geophysics and software
• Near-surface electrical prospecting laboratory at Moscow University
• Faculty of Geology >> Departments

... Ph.D., associate professor, Faculty of Economics and Management, Orel Branch, The Russian Presidential Academy of National Economy and Public Administration. ... The author presents the demand rating of public services in the markets of G2B and G2C, the results of surveys of the Institute for Information Freedom Development. ... The author suggests the basic concept of management in the markets of G2B and G2C the Performance Management. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>272) - ee-journal.spa.msu.ru/ )

... On the Institute . ... Development of relational methods of studying time [Chief: V.V. Aristov, Dr. Sci. (physics and mathematics)] . ... Physics of relic radiation, fundamental interaction mediator, carrier of space and time [Chief: I.M. Dmitrievsky, PhD (technology), Ass. ... Algebraic structure of space-time, algebrodynamics of fields and particles [Chief: V.V. Kassandrov, PhD (physics and mathematics)] . ... Causal mechanics [Chief: S.M. Korotaev, Dr. Sci. (physics and mathematics)] . ...

Еще в разделе: (Показать все результаты (>15) - temporology.bio.msu.ru/ )

... Do those millions of sites and services provide useful information, or are they just "information pollution"? ... Abstract This is a review of electrochemical information and services available on the internet, and some evaluation of their usefulness for professionals, students, and the general public. ... Two examples are the "Internetchemistry" site [26] and the "Electrochemical Science and Technology Information Resource (ESTIR)", which lists over 1,000 links to electrochemistry-related sites [7]...

Еще в разделе: (Показать все результаты (>82) - electr003.chem.msu.ru/ )

• Boris I. Podlovchenko: Selected Publications
• Laboratory of Electrochemical energetics

... Application of the change-point analysis to the investigation of the brain's electrical activity. ... A vast variety of approaches to the extraction of quantitative features from an EEG signal was introduced during more than 70 years of electroencephalography. ... Therefore, statistical approaches seem to be the most feasible and theoretically satisfactory methodology for the quantitative analysis of the EEG signal up to now. ...

Еще в разделе: (Показать все результаты (>62) - brain.bio.msu.ru/ )

• Change-point synchronization between signals or signal components
• Conclusion
• Nonparametric approaches to the description of EEG piecewise stationary

. Links . arXiv.org (Lanl gov) . Large amount of articles . http://arXiv.org . Scientific Electronic Library . http://www.elibrary.ru . Elsevier Science; Kluwer Academic Publishers; Springer Berlin Heidelberg . and others... Laboratory of Theoretical Nonlinear Dynamics in Institute of Radio-Engineering and Electronics of RAS, Saratov Branch IRE RAS . http://www.sgtnd.tserv.ru . Head of the group Doctor of Sciences, Professor Sergey P. Kuznetsov . Painter Andrey Isaev . http://www.IsaevArt.ru .

Еще в разделе: (Показать все результаты (>63) - chaos.phys.msu.ru/ )

• Science
• Activities

... COLAMO [1] . Fire!Constructor [2], . ... Fire!Constructor ( Include COLAMO). ... 4 - Fire!Constructor COLAMO - ARGUS. ... ARGUS : Define N = 5; Define K = 6; Define M = 1; DMC[0.A] # Metka : Read A step M repeat K; Add A, K; Loop N Goto Metka; DMC[0.C] # Metka1 : Read C step M repeat K; Add C, K; Loop N Goto Metka1; DMC[0.D] # Metka2 : Read D step M repeat K; Add D, K; Loop N Goto Metka2; DMC[0.B] # Metka3 : Write B step M repeat K; Add B, K; Loop N Goto Metka3; Read ­ , (.. ...

Еще в разделе: (Показать все результаты (>4) - fpga.parallel.ru/ )

• Терминология

... CUBLAS и CUFFT - прикладные библиотеки, использующие CUDA для умножения матриц и преобразования Фурье. CUDA Data-Parallel Primitives Library - библиотека некоторых распространенных операций с данными, реализованных при помощи CUDA. ... ACML-GPU - процедуры математической библиотеки AMD ACML, реализованные на графическом процессоре. ...

Еще в разделе: (Показать все результаты (>3) - gpu.parallel.ru/ )

... OK ======================================= To compile CompHEP input make command ======================================= make # command output : ****************************************************************** * CompHEP -4.4p3 has been successfully built * * * * Please create a user working directory using the command * * make setup WDIR=path_to_your_user_work_dir * * NOTE: Do not use '~' to refer to home ... CompHEP-interfaces-1.0.1 has been installed successfully!! ...

Еще в разделе: (Показать все результаты (>4) - lhe.sinp.msu.ru/ )

... Клуб выпускников / Доска объявлений . клуб выпускников члены клуба вступить в клуб наши партнеры . Поиск работы и вакансии . ... Для участия в разработке информационных систем для гражданской авиации (Linux, C++, Oracle) с возможностью проявить себя требуются программисты C++. ... приветствуется знакомство с Unix/Linux, SQL, любой уровень знания английского . ... премии по результатам работы . место работы - рядом с м. Динамо . ... URL: http://http://www.sirena2000.ru/sirena/about.html . ...