... Number of required sensors is 10000 4 The part of ANTARES collaboration (http://antares.in2p3.fr/Collaboration/index.html) 5 The some direction of MSU group activity in the project · Bioluminescence cut · Quality cuts · SN search 6 Bioluminescence cut We have collected distributions of hit counts for each PMT during one K40 run (~45min) Usually these distributions consist of 2 parts ­ Poissonian (due to K40 and plankton ... Conclusion Bioluminescence cut was done. ...

Еще в разделе: (Показать все результаты (>21) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20ANTARES.pdf
• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%201.pdf
• http://antares.sinp.msu.ru/docs/INFN%20-%20NEMO.pdf

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ HYDROACOUSTIC ANTENNA : A POWERFUL TOOL TO FORECAST TSUNAMIGENIC EARTHQUAKES Yakov S. Karlik Central Research Institute MORPHYSPRIBOR , 46 Chkalovsky proezd, Sankt-Petersburg, 197378 Russia E-mail: karlik@mail.cl.spb.ru ABSTRACT Hydroacoustic antenna ... 2001). ... Eiby, J.A., 1982: Earthquakes. ...

Еще в разделе: (Показать все результаты (>26) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E03_Didenkulova_Peli.pdf
• http://seac47-2.phys.msu.ru/proc/Recommendations.pdf
• http://seac47-2.phys.msu.ru/proc/E22_Watts.pdf

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ­ velocity potential, H ­ depth, ­ vector of bottom deformation, 0 ­ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>49) - ocean.phys.msu.ru/ )

• Index of /courses/stathyd/
• Index of /courses/geo/lib/books/Brown x26; Mussett The Inaccessible Earth/
• Index of /courses/geo/lectures-addons/02/

... International Scientific Conference "Probability Theory and its Applications" on Occasion of the 85-th Birthday of Yu.V.Prokhorov љis organized by the Steklov Mathematical Institute andљFaculty of Computational Mathematics and Cybernetics of Moscow State University fromљ12 to 14 of February, 2015 and will take place at the Faculty of Computational Mathematics and Cybernetics of Moscow State University .љ ...

Еще в разделе: (Показать все результаты (>2) - smu.cmc.msu.ru/ )

... Статистика блога . ... результаты выборов психодиагностика работа с данными скачать SPSS мотивация профессии фото заработок в интернете экспериментальная психология измерение в психологии статьи полезные советы математические методы SPSS Evaluation Version IRT психологические журналы видео ссылки психометрика тестирование компетенции анализ и визуализация данных юзабилити опросы структурное моделирование тесты IBM SPSS Statistics диссертации dropbox графика в R геолокация регрессионный ...

Еще в разделе: (Показать все результаты (>10) - tukachev.flogiston.ru/ )

• Category: Новости
• Coursera?s Computing for Data Analysis course on R

... Home Our Team Staff Lora S. Nikolaeva . ... Kalinin, USSR; graduated from Lomonosov Moscow State University, Mechanics and Mathematics Department in 1961. Work at Lomonosov Moscow State University, Chemistry Department from 1967. ... Joint investigstions with Department of Chemistry of Tver State University and Biology Department of Lomonosov Moscow State University have been made. ... Colloquium on 24.12.12 20 Dec 2012 . ... Department of Chemistry . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• Carbamide Laboratory of Chemical Thermodynamics
• Our Partners Laboratory of Chemical Thermodynamics
• PhDi Laboratory of Chemical Thermodynamics

... Catalog . Publications . ... Koposov, S., Glushkova, E., Zolotukhin, I. 2008: Automated search for Galactic star clusters in large multiband surveys. ... BibTeX entry ] . ... Glushkova, E.V., Zabolotskikh, M.V., Koposov, S.E., Spiridonova, O.I, Vlasyuk, V.V., Rastorguev, A. S. 2010: Photometry of the poorly studied galactic open star clusters King 13, King 18, King 19, King 20, NGC 136, and NGC 7245 , Astronomy Letters, 36, 75 . ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI OCL Catalog The Team
• SAI Open Star Clusters (SAI OCL) Catalog
• SAI OCL Catalog Virtual Observatory

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>11) - belyakov.imec.msu.ru/ )

Russian version . ... Leninskie Gory 1, Moscow, 119991, Russia . ... The title is: "The development of resonant X-ray reflectivity method near the L2,3 absorption edges for investigations of magnetic multilayers". ... Moscow. ... Russia. ... A. Smekhova, е.ю. Gan'shina, B.S. Roschin, A.D. Gribova, M.A. Andreeva, F. Wilhelm, A. Rogalev, "Structural and Magnetic Studies of [Co 0.45 Fe 0.45 Zr 0.1 /a-Si] N Multilayers", Journal of Spintronics and Magnetic Nanomaterials, 1 (1), pp.11-17 (2012) [pdf] . ...

Еще в разделе: (Показать все результаты (>29) - magn.phys.msu.ru/ )

• Сотрудники кафедры магнетизма: Перов Николай Сергеевич
• Сотрудники кафедры магнетизма: Родионова Валекрия Викторовна
• Сотрудники кафедры магнетизма: Радковская Анна Александровна

Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...

Еще в разделе: (Показать все результаты (>5) - newcryst.phys.msu.ru/ )

• List of Publications Naumova

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... A comparative study of thermodynamic for both natural and artificial RNA/DNA ­ protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA ­ protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...

Еще в разделе: (Показать все результаты (>5) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf
• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf

Faculty of Global Studies, Lomonosov Moscow State Uiversity Information Sheet 2014- 2015 GENERAL INFORMATION University Website Faculty Website for Exchange Students Academic Guide for Exchange Students Mailing Address of the Faculty (for courier delivery as well) Contact Information of the international department of the Faculty http://www.msu.ru/ http://fgp.msu.ru/ http://fgp.msu.ru/ru/ ... The faculty provides exchange students with the dormitory. ...

Еще в разделе: (Показать все результаты (>123) - fgp.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf
• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf

... About the project . ... Biological information . As part of the project areas we will develop the scientific basis for the creation of infrastructure solutions and knowledge-based platforms for a comprehensive biodiversity study in Russia on the basis of genomic and storage technologies, analysis and exchange of data different types. ... Solution of problems set out in the project area will have the long-term effect in the various fields of science and engineering disciplines in the social sphere. ...

Еще в разделе: (Показать все результаты (>15) - depository.msu.ru/ )

• Plants | depozitariy
• Animals | depozitariy

DNS Security, Stability and Resiliency John Crain Chief Technical Officer April 21st 2009 Garmisch 1 Monday, 20 April 2009 Agenda · The Global DNS SSR Symposium · Problems and Opportunities · Questions? ... The level of awareness with respect to the DNS is very low" ­ All quotes from Symposium Report 7 Monday, 20 April 2009 Problems & Opportunities 8 Monday, 20 April 2009 Problem: · There is a need for training across all sectors of the industry to raise both skills and awareness. ...

Еще в разделе: (Показать все результаты (>18) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>12) - iconolat13.phys.msu.ru/ )

• Visa to entry Russia
• Program topics
• Symposia

... id #1550 . Journal of Immune Based Therapies and Vaccines [J Immun Based Therap Vaccin] . Common information . ... no information] . ... 1476-8518 . ... since 2003-01-01 till today . ... FREE electronic journal! ... http://www.jibtherapies.com/home/ . ... today . ...

Еще в разделе: (Показать все результаты (>124) - journals.genebee.msu.ru/ )

• JCatalog - Список журналов
• JCatalog journal list