... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...

Еще в разделе: (Показать все результаты (>73) - music.genebee.msu.ru/ )

... Сен 19 . Юрий (admin) Новости диссертации , юмор No Comments . ... Юрий (admin) Новости измерение , Лайкерт , математические методы , опросник , опросы , порядковые шкалы , психодиагностика , шкала No Comments . ... Юрий (admin) Новости книги , научно-популярная литература , ссылки , эксперименты No Comments . ... Юрий (admin) Новости организационная психология , оценка персонала , психодиагностика , психологические тесты , психологическое тестирование , тестирование No Comments . ...

Еще в разделе: (Показать все результаты (>5) - tukachev.flogiston.ru/ )

• Likert-Type Scale Response Anchors

MEIS : ­ 2007 ­ 3/802 537.9 538.975 P.N.Chernykh, G.A Iferov., ... S. Abo, S. Ichihara, T. Lohner, F. Wakaya, T. Eimori, Y. Inoue, M. Takai, Nuclear Instruments and Methods in Physics Research B237 (2005) 72. ... D.P.Woodruff, Nuclear Instr. and Methods in Phys. Research B256 (2007) 293. ... T.Gustafsson, H.C. Lu, B. W. Busch, W. H. Schulte, E. Garfunkel, Nuclear Instr. and Methods in Physics Research B183 (2001) 146. ... L.R. Doolittle, Nuclear Instr. and Methods in Physics Research B9 (1985) 344. ...

Еще в разделе: (Показать все результаты (>59) - danp.sinp.msu.ru/ )

... 2 What is MATLAB ?? Basic Matrix Operations Script Files and M-files Some more Operations and Functions APPLICATIONS: Plotting functions .. ... Vectors are special forms of matrices and contain only one row OR one column. Scalars are matrices with only one row AND one column MATLAB Matrices 17 A matrix with only one row AND one column is a scalar. A scalar can be created in MATLAB as follows: » a_value=23 a_value = 23 MATLAB Matrices 18 A matrix with only one row is called a row vector. ...

Еще в разделе: (Показать все результаты (>7) - imaging.cs.msu.ru/ )

... Measurement of the MASS detectors parameters with mass program January 24, 2015 [112707] . MASS/DIMM electronics. ... Turbina-core(D): Dimm User Guide. ... N.Shatsky, V.Kornilov, The revision of the MASS/DIMM star catalogue. ... О.Возякова, В.Корнилов, Н.Шатский, Новое программное обеспечение прибора MASS/DIMM. ... V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site. ...

Еще в разделе: (Показать все результаты (>27) - curl.sai.msu.ru/ )

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>2) - swx.sinp.msu.ru/ )

... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...

Еще в разделе: (Показать все результаты (>2) - unesco.fgp.msu.ru/ )

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>2) - mouse.belozersky.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• StructAlign feedback
• Align tool for DNA-protein complexes

... include stdio.h # include stdlib.h int main( int argc, const char* argv[]) { FILE* f; int c, wordCnt = 0, inWord = 0; if (argc 2) { printf ( Use: %s filename\n , argv[0]); return 1; } f = fopen(argv[1], r ); if (f == NULL) { printf ( Can't open file: %s\n , argv [1]); return 1; } while ((c = fgetc(f)) if (!isspace(c)) if (! inWord ) { ++wordCnt; inWord = 1; } } ... int main() { enum {RUNNING, STOPPED} state; state = RUNNING; state = STOPPED; } RUNNING STOPPED · : 1. ...

Еще в разделе: (Показать все результаты (>2) - savenkov.lvk.cs.msu.su/ )

• http://savenkov.lvk.cs.msu.su/mc/lect04.pdf

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>6) - npidb.belozersky.msu.ru/ )

PHYSICAL REVIEW A, VOLUME 61, 052305 Analysis of radiatively stable entanglement in a system of two dipole-interacting three-level atoms I. V. Bargatin, B. A. Grishanin, and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, Moscow 119899, Russia Received 29 November 1999; published 7 April 2000 We explore the possibilities of creating radiatively stable entangled states of ... II only two transitions in the whole system. ...

Еще в разделе: (Показать все результаты (>69) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/PRA22309.pdf
• http://qilab.phys.msu.ru/papers/FortschrPhys-2000-en.pdf
• http://qilab.phys.msu.ru/papers/UFN-2001-44(6)-en.pdf

... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...

138. http://qi.phys.msu.ru/papers/2011-jetpl(e)-94-262.pdf

139. Общеуниверситетские подготовительные курсы

140. http://storage.bioinf.fbb.msu.ru/~roman/mol_biol_mosk_2006.pdf