Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>10) - lvk.cs.msu.su/ )

... Distribution of neutron counting rate near the Earth surface is studied in two directions - to the Earth and from it - according experimental data, obtained in Moscow in 1996. ... We suppose that logarithmically normal distribution describes an input of the Earth crust into the neutron flux. ... Usual periods . ... Full approximation of thermal neutrons distribution near the Earth crust is presented as a sum of two functions - Poison distribution and logarithmically normal distribution. ...

Еще в разделе: (Показать все результаты (>110) - www.kosmofizika.ru/ )

• Science Technology: Ongoing Solar Activity

... Main emphasis is placed on investigations of transformations in simple metal oxides (zinc, aluminum, silicon, etc.), as well as synthesis of complex oxides by thermal treatment in water vapors (thermal vapor treatment - hydrothermal process at clement conditions: temperature 150 - 420Аб, water vapor pressure 2 - 300 atm). ... Danchevskaya M.N., Ivakin Yu.D., Muravieva G.P., Zuy A.I. On peculiarities of transformations in activated hydrargillite at thermal vapor conditions. ...

Еще в разделе: (Показать все результаты (>51) - www.kge.msu.ru/ )

• Archive

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>5) - www.eng.geogr.msu.ru/ )

The opinion of the members of the Russian Rectors ' Union delegation of the results of the Fourth All- Russian Students ' Forum The Vice-president of the Russian Rectors ' Union, Chairman of the Council of Rectors of higher educational institutions of the Siberian Federal District and the Novosibirsk region, Rector of Novosibirsk State Technical University N.V. PUSTOVOY: The participation of the Russian ...

Еще в разделе: (Показать все результаты (>48) - www.rsr-online.ru/ )

• Structure

NEMO Mini-Tower Floor Simulation construction Normalized Value X 'V X= N V ­ volume N ­ number of decays X' ­ number of coincidence Simulation results Data packet P ack et s r o w P ack et s r o w Experimental data processing Experimental data processing Coincidence rate PMT_IDs 1-2 3-4 5-6 7-8 9-10 11-12 13-14 15-16 Coincidence ...

Еще в разделе: (Показать все результаты (>27) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%202.pdf
• http://antares.sinp.msu.ru/seminar/Gracheva.pdf
• http://antares.sinp.msu.ru/docs/Gracheva_Bamberg_22.09.11.pdf

... Spontaneous chemiluminescence of seedling roots is a result of lightning of cell' surface of roots [mainly growth and root hair zones]. ... There is a "burst" of spontaneous chemiluminescence (oxidative stress) when plant roots are situated in stress conditions (high and low temperatute, salt, osmotic, abiotic- and biotoxines). ... Veselovsky V.A., Sekamova E.N., Tarusov B.N. On mechanism of spontaneous luminescence of organisms. ... Veselovsky, V.A., Veselova, T.V. Spontaneous luminescence. ...

Еще в разделе: (Показать все результаты (>10) - biophys.msu.ru/ )

• CURRICULUM VITAE

... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...

Еще в разделе: (Показать все результаты (>3) - sphere.sinp.msu.ru/ )

... Submit your article . ... Public Administration publishes scholarly articles on theory, methodology and practice of management, results of applied research projects in administration, studies of Russian and foreign administration experience, bibliographical reviews and information on conferences, round tables and workshops. ... The journal accepts polemic articles. ... All articles submitted for publication are first reviewed for compliance with the guidelines for article formatting and content. ...

Еще в разделе: (Показать все результаты (>294) - ee-journal.spa.msu.ru/ )

... Control of the Self Assembly Processes in a Droplet of a Colloidal Solution by an Acoustic Field O. V. Rudenkoa, P. V. Lebedev Stepanovb, V. A. Guseva, A. I. Korobova, B. A. Korshaka, N. I. Odinaa, M. Yu. ... The self assembly in the course of solvent evapora tion occurs owing to capillary forces, which displace the particles in the near surface layers of the solution as the volume of the latter decreases. ... For simplicity, we replace the actual droplet on a solid substrate by a plane liquid layer...

Еще в разделе: (Показать все результаты (>47) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/lecture/matmodel.pdf

Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics . ... Links . ... CDFE => Links . ... Space Physics Online Data Services at MSU SINP . Japan Atomic Energy Research Institute Nuclear Data Center . Korean Atomic Energy Research Institute Nuclear Data Center . MacNuclide Nuclear Data Base Management System . ... Radiation Safety Information Computational Center , Oak Ridge National Laboratory . ... Los Alamos National Laboratory Nuclear Data Viewer . ...

Еще в разделе: (Показать все результаты (>26) - cdfe.sinp.msu.ru/ )

• About CDFE
• How to contact CDFE
• CDFE Activities

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Проблемы с MSDN, что c VS2005 Feb CTP . ... Re: Проблемы с MSDN, что c VS2005 Feb CTP [ re: dimich ] . ... А кто-нибудь ставил VS2005 Feb CTP + MSDN (что с ним же)? ...

Еще в разделе: (Показать все результаты (>4831) - www.snto-msu.net/ )

• eD2k: какой хэш используют в ссылке? - Public forum of MSU united student
• Продам computer без блока питания и HDD - Public forum of MSU united student
• Объявления о PhD, Postdoc, Schools, Confs etc. - Public forum of MSU united

Symbolic circuit-matrix processor and evaluator . ... This software is reliable over the range of benchmark circuit complexity (both *.CIR and *.MAT file). ... SYMBOL is a symbolic-algebra package which in contrast to REDUCE, MACSYMA, MAPLE, MATHEMATICA, MathLAB, MathCAD and other known multi-purpose systems is especially intended for analysis of any lumped, linear, time-invariant circuit. ... pure ASCII text . ... CIRSYM - SYMbolic CIRcuit processor used to format ASCII text file *.out for CALCSYM. ...

Еще в разделе: (Показать все результаты (>27) - astrometric.sai.msu.ru/ )

• Computer....

... B Design and developmentof a new vacuum chamber for the tests of Q-factors in suspension's modes . ... E New SQL free principle of coordinate monitoring of the test mass . F Appendix I . ... The achieved p new resolution 2 10;11cm= Hz was su cient to record Brownian vibration with relative accuracy better than 10% (see details in Appendix I). ... See details in Appendix IV) E. New SQL free principle of coordinate monitoring of the test mass The new concept of quantum measurement | ...

Еще в разделе: (Показать все результаты (>101) - hbar.phys.msu.ru/ )

• http://hbar.phys.msu.ru/gorm/dating/coins1.pdf
• http://hbar.phys.msu.ru/articles/ligorep02.pdf
• http://hbar.phys.msu.ru/hbar/pages/vyat/vyate.html

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>18) - lcc.chem.msu.ru/ )

... Российский фонд фундаментальных исследований, в рамках Соглашения с Нидерландской организацией по научным исследованиям (NWO), объявляет конкурс 2005 года совместных исследовательских проектов групп голландских и российских ученых по следующим областям знаний: . ... Согласованные заявки на участие в конкурсе представляются голландскими со-руководителями проекта через систему удаленной регистрации NWO, российскими со-руководителями проекта в 2-х печатных экземплярах в РФФИ, до 31 августа 2005 года . ...

Еще в разделе: (Показать все результаты (>605) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: IN VITRO ВЛИЯНИЕ ОПЕРАТОРА ЦИГУН НА ИЗМЕНЕНИЕ
• Клуб выпускников МГУ: Современные устройства магниторезонансной терапии и
• Клуб выпускников МГУ: Виза F-1 для студентов в США

... Study of the nature and magnitude of buffer capacity in various soils, information on mechanisms of buffer reactions is required to predict the rates of further acidification and to estimate the critical loads. ... The problem of estimation of soil sustainability to acid deposition is considered. ... The uncertainty in the estimated critical load values can be rather large due to uncertainty in critical chemical values for the soil as for a receptor, assessment method and data. ...

Еще в разделе: (Показать все результаты (>32) - eco.soil.msu.ru/ )

• CLEANSOIL, An innovate method for the on-site remediation of polluted soil
• TRANSFORMATION AND STABILITY OF SOILS IN FOREST ECOSYSTEMS UNDER IMPACT OF
• Forest ecosystem data in Norwegian-Russian border area

... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...

Еще в разделе: (Показать все результаты (>15) - depository.msu.ru/ )

• Biological information | depozitariy
• Scientific results | depozitariy
• Plants | depozitariy

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>13) - iconolat13.phys.msu.ru/ )

• Program topics
• Guidelines