. Rolling Simplexes and their Commensurability. (Axiom and Criterion of Incompressibility, Momentum Lemma) / Razmyslov Yu.P. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. 2011. ? 5. P. 55-58 [Moscow Univ. Math. Bulletin. Vol. 66, N 5, 2011.]. The total geometrical theory of field is recreated. Key words : projective plane, affine chart, rolling, incompressibility, desargues condition, field. ? 5/2011 . Toggle formulas format . (LaTeX / SVG)

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>133) - vestnik.math.msu.su/ )

... 2 What is MATLAB ?? Basic Matrix Operations Script Files and M-files Some more Operations and Functions APPLICATIONS: Plotting functions .. ... Vectors are special forms of matrices and contain only one row OR one column. Scalars are matrices with only one row AND one column MATLAB Matrices 17 A matrix with only one row AND one column is a scalar. A scalar can be created in MATLAB as follows: » a_value=23 a_value = 23 MATLAB Matrices 18 A matrix with only one row is called a row vector. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>15) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.su/~yurin/Doxyfile

... Alexei Lidov.. ... The creation of sacred space as a form of creativity and subject of cultural history .. ... 91 Mikhail V. Bibikov Byzantine Eden: "time in space" .. ... 140 Svetlana Popovi The Byzantine Monastery: its Spatial Iconography and the Question of Sacredness .. ... 525 762 Milena Rozhdestvenskaya The Creation of Sacred Space in Medieval Russian Literature: apocrypha and chronicles .. ... 556 Vladimir V. Sedov The Sacred Space of the Medieval Russian Church: the Architectural Aspect .. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>23) - imk.msu.ru/ )

• Èíñòèòóò ìèðîâîé êóëüòóðû ÌÃÓ

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>6) - tex.bog.msu.ru/ )

• http://tex.bog.msu.ru/rustexeo.html

About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>83) - textbook.sinp.msu.ru/ )

Cassa depositi e prestiti spa Long-Term Instruments for financing Infrastructure Franco Bassanini Chairman of Cassa Depositi e Prestiti Institute of the Russian Academy of Sciences September 22, 2010, Moscow Cassa depositi e prestiti spa Global capitalism and short-termism · The short-termism that characterized recent global capitalism had negative effects on the ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>23) - www.mse-msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>13) - mouse.genebee.msu.ru/ )

• ConClus

... x25BA; Login to the site . Skip to create new account . Login here using your username and password . ... Username . Password . ... Some courses may allow guest access . ... For full access to courses you'll need to take a minute to create a new account for yourself on this web site. ... You can now access the full course. From now on you will only need to enter your personal username and password (in the form on this page) to log in and access any course you have enrolled in. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>2) - moodle.ffl.msu.ru/ )

... News . For 1st and 2nd-year students . Introduction to quantum physics . ... About us . ... Create new account (active tab) . ... Request new password . E-mail * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. Create new account . ... 2003 2016 Department of Quantum Electronics . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>4) - quantum.phys.msu.ru/ )

... x25BA; Login to the site . Skip to create new account . Login here using your username and password . ... Username . Password . ... Some courses may allow guest access . ... For full access to courses you'll need to take a minute to create a new account for yourself on this web site. ... You can now access the full course. From now on you will only need to enter your personal username and password (in the form on this page) to log in and access any course you have enrolled in. ...

140. http://danp.sinp.msu.ru/Projects/Preprint_MEIS_End.pdf