Title Author Key words Social inequality and survival strategies of single mothers in the modern economy Semina M.V. social inequality, survival strategies, a single mother, survival strategies of single mothers The author asks: "Are there any specific survival strategies of single mothers or life members of this social group is no different from the lives of other social categories?". This article is an attempt to answer this question based on two of sociological research. Abstract

Еще в разделе: (Показать все результаты (>136) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2015/2/04.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/2/07.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2015/4/09.pdf

CONFERENCE WEBSITE The conference website has been launched: http://stipomat.epfl.ch. ... In case there are any questions that are left open, please do not hesitate to contact us. ... Abstracts and titles should be submitted on-line via the conference website. ... We have a budget from the European Science Foundation, which will enable us to cover the local accommodation costs (full board hotel accommodation in Les Diablerets for the duration of the conference) for 40 - 50 poster presenters. ...

Еще в разделе: (Показать все результаты (>150) - polly.phys.msu.ru/ )

• Научный доклад 26.10.2011
• Seminar in Polymer Physics
• Biography

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

. [ Войти ] . Главная -> Фильмы -> Category 7: The End of the W.. Пользователи . Демо . Деньги . Фильмы . Форум . Category 7: The End of the World . Германия - США 2005 . отметить . Триллер . Боевик . Dick Lowry . Sebastian Spence . Tom Skerritt . Kenneth Welsh . James Brolin . Cameron Daddo . Randy Quaid . Suki Kaiser . Robert Wagner . Nicholas Lea . Swoosie Kurtz . Gina Gershon . Adam Rodriguez . Shannen Doherty . Lindy Booth . John Kapelos .

Еще в разделе: (Показать все результаты (>34) - kinfo.ru/ )

• Category 6: Day of Destruction - Фильмы - Kinfo.ru

... Research . ... Linguistic expeditions . ... Up to now the subjects to documentation were local dialects of Selkup, Ket, and Evenki. ... 1) creation and enlargement of multimedia computer archives of Selkup, Ket, and Evenki speech, which include sounding dictionaries and folklore texts and life-stories in audio, video, and graphic representation in local dialects of the surveyed villages; development of linguistic multimedia databases; . ... 8) research into the Selkup-Ket-Evenki language contacts; ....

Еще в разделе: (Показать все результаты (>22) - lcl.srcc.msu.ru/ )

. Home . Main information . History . Gallery . People . Our Research . Photonics . Nonlinear spectroscopy . Nonlinear fiber optics . Attosecond optics . Neurophotonics . Nonlinear optics of ionized mediums . Fiber lasers . Collaborations . Publications . Conferences . Grants . Video . Contacts . Laboratory of photonics and nonlinear spectroscopy . Back to Category Overview . Previous . Next . Home Конференции Санкт-Петербург . Powered by Joomla! . Valid XHTML and CSS .

Еще в разделе: (Показать все результаты (>24) - photonicslab.phys.msu.ru/ )

• Gallery - Category: Конференции - Image: Казань ICONO/LAT 2010, дорога туда=)
• Gallery - Category: Конференции - Image: Казань ICONO/LAT 2010
• Gallery - Category: Конференции - Image: LALS, Oulu, Finland 2010

6 апреля 2004 . ... Группы инерции гладких вложений. Классическим и очень интересным объектом дифференциальной топологии является группа $C^k_n$ гладких вложений $S^n$ в $S^{n+k}$ (с точностью до гладкой изотопии). ... Тогда для любых (возможно, не изотопных) вложений $g_1,g_2:S^4\to S^7$ вложения $f\#g_1,f\#g_2:N\to S^7$ изотопны. ... Пусть $f:N\to S^7$ --- гладкое вложение, которое почти гладко изотопно гладкому вложению с образом в $S^6\subset S^7$. ...

Еще в разделе: (Показать все результаты (>151) - higeom.math.msu.su/ )

• Algebraic topology abstracts (Russian)
• Resources (Russian)
• Publications (Russian)

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

... Kkimiya UDC 547.821 DATABASE COVERING THE SYNTHESES OF PYRIDINE S FROM ACYCLIC REAGENTS: THE ROLE OF NONSTANDAR D RETRIEVAL REQUESTS I N DEVELOPING THE STRATEGY OF COMPUTER SYNTHESIS E. V. Babaev and S. V. Tsitovskii Th e methodolog y o f constructin g a databas e covering th e synthese s o f pyridin e ring i n a standar d ChemBas e shel l i s discussed . ... Double lines in the diagrams correspond to the skeleton bonds of the reagents that pass into the skeleton of the pyridine cycle. ...

Еще в разделе: (Показать все результаты (>126) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/030e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/045e.pdf
• Семинар "SciFinder on the Web - информационный ресурс производства Chemical

... Lectures, Questions & Answers . ... Evgeny V. Antipov (Faculty of Chemistry, Moscow State University) New cathode materials for lithium batteries . Questions and Answers . ... Questions . Vladimir I. Feldman (Faculty of Chemistry, Moscow State University) Physics and chemistry of solvated electron . ... Galina A. Tsirlina (Faculty of Chemistry, Moscow State University) Diversity of electrochemistry: the specific problems of molecular models and their experimental verification . ...

Еще в разделе: (Показать все результаты (>26) - www.elch.chem.msu.ru/ )