... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>110) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2013

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

. Number . Task . Pri . Author . Created By Tool . Created On . Modified On . Completed . Modified By . Assigned To . Link To . Magic . Description

Еще в разделе: (Показать все результаты (>46) - genphys.phys.msu.su/ )

• To Do List History

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Higher School of Management and Innovation (Faculty of Lomonosov MSU) was founded in June 2006 by the Academic Council on the initiative of the Moscow State University Rector, academician V.A. Sadovnichiy and Chairman of the Board of Directors of JSFC "Sistema" V.P. Yevtushenko. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• Message from Victor Antonovich Sadovnichy - Rector of Lomonosov Moscow State
• Admission committee | MSU Higher school of management and innovation

Space Weather . ... Main page . ... Data . ... Data base . Satellite trajectory viewer . ... Storage and processing of space experiments, in conjunction with the Internet access system, are the main components of the system of space monitoring. ... CORONAS-F . ... The space monitoring data base contains measurements of domestic satellites since 1983. ... Now the data base continues to be filled up in line with the operational satellites connection timetable(Meteor-M ?1, Electro-L ?1). ...

Еще в разделе: (Показать все результаты (>11) - swx.sinp.msu.ru/ )

• SWX - Главная

... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...

Еще в разделе: (Показать все результаты (>93) - td.chem.msu.ru/ )

• Lora S. Nikolaeva Laboratory of Chemical Thermodynamics
• Research Areas Laboratory of Chemical Thermodynamics

... cheap the north face . ... cheap longchamp . ... cheap ray bans . ... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate key Win 7 ultimate product key windows 7 ...

Еще в разделе: (Показать все результаты (>126) - elana.sinp.msu.ru/ )

• Didn`t suggest we don?t adore determine producer creative designers. We
• cheap moncler The new version also offers enhanced automated orchestration
• dead computer contest | С Днем Победы!

High-peak-power diode-pumped picosecond lasers for scientific, technological and navigational applications International Laser Center of M.V.Lomonosov Moscow State University All-solid-state technology Excellent beam quality Output and input triggering Widely tunable repetition rate Electro-optical operation control Microcontroller design Internal auto-diagnostics Compactness and ease of operation No water cooling Low power consumption PICAR ...

Еще в разделе: (Показать все результаты (>191) - ilc.phys.msu.ru/ )

• Laboratory of solid-state lasers and coherent spectroscopy
• Publication
• Grant detail

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ HYDROACOUSTIC ANTENNA : A POWERFUL TOOL TO FORECAST TSUNAMIGENIC EARTHQUAKES Yakov S. Karlik Central Research Institute MORPHYSPRIBOR , 46 Chkalovsky proezd, Sankt-Petersburg, 197378 Russia E-mail: karlik@mail.cl.spb.ru ABSTRACT Hydroacoustic antenna ... 2001). ... Eiby, J.A., 1982: Earthquakes. ...

Еще в разделе: (Показать все результаты (>26) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E12_Marchuk.pdf
• http://seac47-2.phys.msu.ru/proc/Recommendations.pdf

Russian version . A LIST IN GENERAL LINGUISTICS . ... Russian Network for Social Sciences and Humanities . In section " Our Publications " three articles has appeared (in Russian) . ... Copyright ї 1999 - 2000 Philological faculties, MSU . Any fragment of a site can not be used without the preliminary sanction of the legal owner . The reference to a site is obligatory . The site is created and is maintained А.А.Polikarpov , editor of list. ... Last changed: 31.10.02 . ...

Еще в разделе: (Показать все результаты (>60) - old.philol.msu.ru/ )

• MSU-LGCLL:: Main Page

... Denis G. Gusev . ... M.S., Physics, Moscow State University, 2004, with honor . Second- and third-harmonic generation in coupled microcavities based on all-silicon photonic crystals", PDF . ... Dr. T.V. Dolgova . ... Dr. A.A. Fedyanin . ... D. G. Gusev , I. V. Soboleva, M. G. Martemyanov, T. V. Dolgova, A. A. Fedyanin, O. A. Aktsipetrov, "Enhanced second-harmonic generation in coupled microcavities based on all-silicon photonic crystals", Phys. Rev. B 68 , 233303 (2003). ... 5, 677 (2004). ...

Еще в разделе: (Показать все результаты (>43) - shg.phys.msu.ru/ )

• Intro

February 17 - Raphael Douady(RiskData) Nonlinear polymodels and the measure of risk in scarce data environment Nonlinear Polymodels and the StressVaR: New Risk Concepts for Fund Allocation Raphael Douady, joint work with Ilija I. Zovko, Cyril Coste and Alexander Cherny We introduce a novel approach to risk estimation based on nonlinear "poly-models": rather than one multi-factor model, the risk of an invetsment is represented by a collection of nonlinear dynamic single factor models. ...

Еще в разделе: (Показать все результаты (>84) - new.math.msu.su/ )

• Scientific fields of research of the Department of Theory of Plasticity
• Vestnik Moskovskogo Universiteta. Matematika, Mekhanika

astro-ph/0701766 Первые наземные измерения атмосферного черенковского излучения космических лучей (First ground based measurement of atmospheric Cherenkov light from cosmic rays) . ... Authors: S. Kozlowski et al. astro-ph/0701214 CU Virginis - Первая звезда-пульсар (CU Virginis - The First Stellar Pulsar) . Authors: Barry J. Kellett et al. astro-ph/0701155 Открытие вероятного физически тройного квазара (Discovery of a Probable Physical Triple Quasar) . ... Authors: Ehud Nakar ...

Еще в разделе: (Показать все результаты (>518) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/1006.html
• Новости науки

... Method Detail protected final void init ( ConcreteIndexMap.ZZMap iMap, ConcreteIndexMap.ZZMap lengthsMap) . ... iMap - ZZMap defining the forward transform. protected final void link ( ConcreteIndexMap prev, ConcreteIndexMap.ZZMap iMap, ConcreteIndexMap.ZZMap lengthsMap) . ... prev - ConcreteIndexMap this is composed with. iMap - ZZMap defining the forward transform. lengthsMap - ZZMap defining the reverse transform. protected final void link ( ConcreteIndexMap prev, ConcreteIndexMap.ZZMap iMap) . ...

Еще в разделе: (Показать все результаты (>70) - angel.cs.msu.su/ )

• : Class NetcdfFile
• : Class MultiArrayImpl
• ExtensionFileFilter

... You must have cookies enabled to log in to MediaWiki. ... Retrieved from " http://algcourse.cs.msu.su/teachwiki/index.php/Special:UserLogin " . Special page . 93.180.27.85 . Talk for this IP address . Log in . ... 1-й семестр 2015 г. Материалы по системе ejudge . ... Special pages . ... About MediaWiki . ...

Еще в разделе: (Показать все результаты (>12) - algcourse.cs.msu.su/ )

COACHES . ... Kiseljev Dmitri . Head Coach . ... Lukyanchikov Dmitri . First Base coach, Power Lifting coach . ... Komissarov Dmitri . 3rd Base coach, Power Lifting coach . ... Erjemkin Alexey . ... Chichaev Ivan . ... Rich Reddrop* . ... Frolikov Alexey . ... Kudrjashov Alexander . ... Chichaev jr . ... Ned Reddrop* . ...

Еще в разделе: (Показать все результаты (>7) - mguteam.chat.ru/ )

Russian version . ... Leninskie Gory 1, Moscow, 119991, Russia . ... The title is: "The development of resonant X-ray reflectivity method near the L2,3 absorption edges for investigations of magnetic multilayers". ... Moscow. ... Russia. ... A. Smekhova, е.ю. Gan'shina, B.S. Roschin, A.D. Gribova, M.A. Andreeva, F. Wilhelm, A. Rogalev, "Structural and Magnetic Studies of [Co 0.45 Fe 0.45 Zr 0.1 /a-Si] N Multilayers", Journal of Spintronics and Magnetic Nanomaterials, 1 (1), pp.11-17 (2012) [pdf] . ...

Еще в разделе: (Показать все результаты (>22) - magn.phys.msu.ru/ )

• Название сайта

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )

... What's new . ... The new version of the General Catalogue of Variable Stars (GCVS4.2) revised taking into account the new data accumulated since the 4th GCVS edition for the constellations: Canis Minor, Capricornus The new version of the GCVS ! ... The new version of the General Catalogue of Variable Stars (GCVS4.2) revised taking into account the new data accumulated since the 4th GCVS edition for the constellations: Apus, Cancer, Canes Venatici and Canis Major The new version of the GCVS ! ...

Еще в разделе: (Показать все результаты (>140) - sai.msu.ru/ )

• GCVS Research Group: Recent publications
• Презентация PowerPoint

... Положение об олимпиаде . ... Отборочный этап . ... от Оргкомитет олимпиады школьников "Ломоносов" - Четверг, 25 Февраль 2016, 12:10 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Среда, 3 Февраль 2016, 18:52 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Понедельник, 1 Февраль 2016, 17:12 . ... Оргкомитет олимпиады школьников ?Ломоносов? приглашает вас к сотрудничеству с целью организации и проведения заключительного этапа Олимпиады на вашей базе по различным профилям. ...

Еще в разделе: (Показать все результаты (>3) - olymp.msu.ru/ )